back Return to this vector's summary.
ID   BSBP       preliminary; circular DNA; SYN; 3210 BP.
XX
AC   ATCC67724;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector BSB+ - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pcDpoly from pL1 & pcDV1 & BlueScribe M13+
RC   pcDpolyB from pcDpoly & oligo
RC   pXPRS+ or pCDpolyB+ from pcDpolyB & BlueScribe M13+
RC   pXPRS- or pCDpolyB- from pcDpolyB & BlueScribe M13+
RC   BSB+ from BlueScribe M13+ & oligo
RC   BSB- from BlueScribe M13- & oligo
RA   Pruitt S.C.;
RT   "Expression vectors permitting cDNA cloning and enrichment for
RT   specific sequences by hybridization/selection";
RL   Gene 66:121-134(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   BSB+ (away from cloning site) and BSB- (toward cloning site) differ in
CC   their orientation of the intergenic region from bacteriophage f1.
CC   This vector contains the integenic region from bacteriophage f1
CC   permitting synthesis of single-strand copies of the insert.
CC   A plasmid vector containing convenient priming sites for sequence
CC   analysis and synthesis of RNA in either direction from T3 and T7
CC   promoters.
CC   Constructed from Bluescribe M13+ by insertion of a synthetic BstXI
CC   adapter between the PstI and XbaI sites of the polylinker region.
CC   Restriction digests of the clone give the following sizes (kb):
CC   NdeI/HindIII--2.5, 0.7; NdeI--3.2; PstI--uncut; BamHI--3.2;
CC   PvuII--2.7, 0.5. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (BSB+)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (BlueScribe M13+)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. BlueScribe M13+ remove XbaI-PstI 16bp
FT                   \ 909..925, MCS/3189bp
FT                   2. oligo XbaI-BstXI-PstI 22bp ctagagccacccccctggtgca
FT                   -> BSB+ 3210bp"
FT   -               1..908
FT                   /note="BlueScribe M13+ 1..908 908bp
FT                   XbaI = T^CTAGA
FT                   \        ctaga..."
FT   -               909..930
FT                   /note="ctagagccacccccctggtgca 22bp
FT                   \   ...gtgca
FT                   PstI = CTGCA^G"
FT   -               931..3210
FT                   /note="BlueScribe M13+ 925..3204 2280bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-KpnI-SmaI-XbaI-BstXI-PstI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique BstXI-BamHI-KpnI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T3"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 3210 BP; 818 A; 793 C; 823 G; 776 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggaaat
     tgtaaacgtt aatattttgt taaaattcgc gttaaatttt tgttaaatca gctcattttt
     taaccaatag gccgaaatcg gcaaaatccc ttataaatca aaagaataga ccgagatagg
     gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg actccaacgt
     caaagggcga aaaaccgtct atcagggcga tggcccacta cgtgaaccat caccctaatc
     aagttttttg gggtcgaggt gccgtaaagc actaaatcgg aaccctaaag ggagcccccg
     atttagagct tgacggggaa agccggcgaa cgtggcgaga aaggaaggga agaaagcgaa
     aggagcgggc gctagggcgc tggcaagtgt agcggtcacg ctgcgcgtaa ccaccacacc
     cgccgcgctt aatgcgccgc tacagggcgc gtcgcgccat tcgccattca ggctgcgcaa
     ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg cgaaaggggg
     atgtgctgca aggcgattaa gttgggtaac gccagggttt tcccagtcac gacgttgtaa
     aacgacggcc agtgaattgt aatacgactc actatagggc gaattcgagc tcggtacccg
     gggatcctct agagccaccc ccctggtgca ggcatgcaag cttttgttcc ctttagtgag
     ggttaattcc gagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc
     cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct
     aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa
     acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta
     ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc
     gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg
     caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt
     tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa
     gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct
     ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc
     cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg
     tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct
     tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag
     cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga
     agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga
     agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg
     gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag
     aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag
     ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat
     gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct
     taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac
     tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa
     tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg
     gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt
     gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca
     ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt
     cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct
     tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg
     cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg
     agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg
     cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa
     aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt
     aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt
     gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt
     gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca
     tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat
     ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata
     aaaataggcg tatcacgagg ccctttcgtc
//