back Return to this vector's summary.
ID   BSIITKSM   preliminary; circular DNA; SYN; 2997 BP.
XX
AC   IG6006;
XX
DT   02-NOV-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector BSII TKS- - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   BSII TKS- from pBluescript II KS- & oligo
RC   BSII TSK- from pBluescript II SK- & oligo
RA   Ichihara Y., Kurosawa Y.;
RT   "Construction of new T vectors for direct cloning of PCR products";
RL   Gene 130:153-154(1993).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (BSII TKS-)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript II KS-)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBluescript II KS- AspEI 2961bp 2047..2047,
FT                   \ amp/2041..2043 & 2049..2051
FT                   mutagenesis
FT                   EcoRI 2961bp 708..708
FT                   2. oligo EcoRI-AspEI-BglII-AspEI-EcoRI 36bp
FT                   \ aattcggactgtgtgtcagatctgactaagggtcgg
FT                   -> BSII TKS- 2997bp"
FT   -               1..707
FT                   /note="pBluescript II KS- 1..707 707bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               708..743
FT                   /note="aattcggactgtgtgtcagatctgactaagggtcgg 36bp
FT                   \...gtcgg
FT                   EcoRI = G^AATTC"
FT   -               744..2076
FT                   /note="pBluescript II KS- 708..2040 1333bp"
FT   -               2077..2079
FT                   /note="nnn 3bp
FT                   AspEI = GACNNN^NNGTC
FT                   \       nnn"
FT   -               2080..2084
FT                   /note="pBluescript II KS- 2044..2048 5bp"
FT   -               2085..2087
FT                   /note="nnn 3bp
FT                   AspEI = GACNNN^NNGTC
FT                   \                nnn"
FT   -               2088..2997
FT                   /note="pBluescript II KS- 2052..2961 910bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2997 BP; 713 A; 762 C; 745 G; 771 T; 6 other;
     ctgacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga
     ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg
     ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat
     ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg
     ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata
     gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt
     tataagggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat
     ttaacgcgaa ttttaacaaa atattaacgc ttacaatttc cattcgccat tcaggctgcg
     caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg
     gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg
     taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tggagctcca
     ccgcggtggc ggccgctcta gaactagtgg atcccccggg ctgcaggaat tcggactgtg
     tgtcagatct gactaagggt cggaattcga tatcaagctt atcgataccg tcgacctcga
     gggggggccc ggtacccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt
     aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca
     tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat
     taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt
     aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct
     cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
     aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
     aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
     tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
     caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
     cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
     ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
     gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
     agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
     gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
     acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
     gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
     gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
     cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
     caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
     gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
     cagcgatctg tctatttcgt tcatccatag ttgcctnnnt ccccnnngtg tagataacta
     cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
     caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
     gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
     gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt
     cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta
     catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca
     gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta
     ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct
     gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg
     cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac
     tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact
     gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa
     atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt
     ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat
     gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccac
//