back Return to this vector's summary.
ID   EMBL3LFARM preliminary; circular DNA; SYN; 20067 BP.
AC   U02425; U02453; X58667; X58668; X06780; IG1003; ATCC37266;
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phage vector lambda EMBL3 left arm - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   from EMBL3
RC   from EMBL4
RC   from EMBL12
RA   Frischauf A.M., Murray N.E., Lehrach H.;
RT   "Lambda phage vectors - EMBL series";
RL   Meth. Enzymol. 153:103-115(1987).
RN   [2]
RC   EMBL1 from lambda 1059 & pBR322
RC   EMBL2 from EMBL1
RC   [pUC2 from M13mp2]
RC   pUC(S-Bg), pUC(R-Bg) from pUC2
RC   EMBL3 from EMBL2Sal & EMBL2RI & pUC(S-Bg)
RC   EMBL4 from EMBL2Sal & EMBL2RI & pUC(R-Bg)
RC   EMBL3AamBam, EMBL3Sam7, EMBL3Aam, EMBL3Bam from EMBL3
RC   EMBL3AamSam, EMBL3BamSam from EMBL3
RA   Frischauf A.M., Lehrach H., Poustka A., Murray N.E.;
RT   "Lambda replacement vectors carrying polylinker sequences";
RL   J. Mol. Biol. 170:827-842(1983).
RN   [3]
RC   from EMBL3
RC   from EMBL4
RC   from EMBL12
RA   Karn J.M., Brenner S., Barnett L.;
RT   "New bacteriophage lambda vectors with positive selection for
RT   cloned inserts";
RL   Meth. Enzymol. 101:3-19(1983).
RN   [4]
RC   from EMBL3
RC   from EMBL4
RC   from EMBL12
RC   from lambda gt series
RC   from M13 series
RA   Maniatis T., Fritsch E., Sambrook J.;
RT   ;
RL   Molecular Cloning 0:248-248(1989).
RL   Maniatis T., Fritsch E., Sambrook J.;
RL   2nd Ed., Cold Spring Harbor Laboratory, New York.
RN   [5]
RC   from EMBL3
RC   from EMBL4
RC   from EMBL12
RA   Kaiser K., Murray N.E.;
RT   "The use of phage lambda replacement vectors in the construction
RT   of representative genomic DNA libraries";
RL   DNA Cloning 1:1-47(1985).
RL   Glover D.M., ed., IRL Press, Oxford.
RN   [6]
RC   lambda from E. coli, gamma gene
RA   Zissler J., Signer E., Schaefer F.;
RT   "The role of recombination in growth of bacteriophage lambda I. the
RT   gamma gene";
RL   The Bacteriophage Lambda 0:455-468(1971).
RL   Hershey A.D., ed., Cold Spring Harbor Laboratory, New York.
RN   [7]
RC   from EMBL3, polylinker
RC   from EMBL4, polylinker
RA   Manninen I., Schulman A.H.;
RT   "The lambda EMBL3 polylinker and surrounding region for PCR primers";
RL   Biotechniques 14:174-174(1993).
RN   [8]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Goedert M., Rogers J., Wilson P.W.;
RT   ;
RL   Submitted (08-FEB-1988) to GenBank by:
RL   Goedert M., Rogers J., Wilson P.W.,
RL   Department of Physiology, University of Cambridge, Downing Street,
RN   [9]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Schulman A.H.;
RT   ;
RL   Submitted (27-MAR-1991) to GenBank by:
RL   Schulman A.H., Institute of Biotechnology, University of Helsinki,
RL   Karvaamokuja 3, SF-00380 Helsinki, FINLAND.
RN   [10]
RP   1-20067, 1-9170
RC   EMBL3 right/left arm
RA   Kitts P.A.;
RT   "CLONTECH Vectors On Disc version 1.1";
RL   Unpublished (1993).
RN   [11]
RP   1-20067, 1-9170
RC   EMBL3 right/left arm
RA   Kitts P.A.;
RT   ;
RL   Submitted (07-OCT-1993) by:
RL   Kitts P.A., CLONTECH Laboratories, Inc.,
RL   4030 Fabian Way, Palo Alto, CA 94303, USA.
CC   EMBL3 size is between 43000 and 44000 bp.
CC   left arm is 19300. right arm is 9200 bp. The stuffer is 14000 bp.
CC   Phage with inserts have the Spi- phenotype. [3]
CC   lambdaEMBL3 (ATCC 37266) and lambdaEMBL4 (ATCC 37267) differ only in
CC   the orientation of the MCS surrounding the stuffer fragment.
CC   Medium is 1592 SM buffer.
CC   This sequence has been compiled from information in the sequence
CC   databases, published literature and other sources; this vector has
CC   not been completely sequenced. If you suspect there is an error in
CC   this sequence, please contact CLONTECH's Technical Service
CC   Department at (415) 424-8222 or (800) 662-2566, extension 3 or
CC   NCBI gi: 413791
CC   NCBI gi: 413819
CC   NM (lambda EMBL3)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)(linear)
CC   ST ()
CC   TY (phage)
CC   SP (CLONTECH)(Promega)(Stratagene)(ATCC)
CC   HO (E.coli LE392)(E.coli O358)(E.coli O359)(E.coli K803)
CC   HO (E.coli NM538)(E.coli NM539)(E.coli KW251)
CC   HO (E.coli XL-1-Blue MRA)(E.coli XL-1-Blue MRA P2)
CC   CP ()
CC   FN (cloning 8000-23000 bp)(chromosome walking)
CC   SE ()
CC   PA (lambda 1059)
CC   OF ()
CC   OR (E.coli Y1090)
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. lambda 1059 remove middle HindIII-HindIII
FT                   \ 21011bp, lambda 23131..44142/27491bp
FT                   \ lambda 23131 25158 27480 36896 37460 44142
FT                   2. E. coli HindIII-HindIII 5700bp, trpE gene
FT                   -> EMBL1 33200bp
FT                   1. EMBL1 EcoRI, lambda 21227
FT                   \ lambda 21227 26105 31748 39169 44973
FT                   mutation
FT                   EcoRI, lambda 44973
FT                   mutation
FT                   -> EMBL2 33200bp [no EcoRI]
FT                   1. M13mp2, MCS
FT                   -> pUC2
FT                   1. pUC2 EcoRI 2200bp, pUC4 327 or 369
FT                   EcoRI-BglII-EcoRI linker 18bp gaattcagatctgaattc
FT                   EcoRI-EcoRI
FT                   -> pUC(R-Bg) 2200bp [EcoRI-BglII-EcoRI]
FT                   1. pUC2 SalI 2200bp, pUC4 342 or 354
FT                   SalI-BglII-SalI linker 18bp gtcgacagatctgtcgac
FT                   SalI-SalI
FT                   -> pUC(S-Bg) 2200bp
FT                   \ [EcoRI-BamHI-SalI-BglII-SalI-BamHI-EcoRI]
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(R-Bg) BglII 2200bp
FT                   -> EMBLRI
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(S-Bg) BglII 2200bp
FT                   -> EMBLSal
FT                   1. EMBLRI remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage
FT                   1. EMBLSal remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage2
FT                   1. EMBLRI middle EcoRI-EcoRI 2200bp
FT                   2. phage2 remove middle EcoRI-EcoRI, 27000bp
FT                   -> EMBL3 29237bp
FT                   1. EMBLSal middle EcoRI-EcoRI 2200bp
FT                   2. phage remove middle EcoRI-EcoRI, 40800bp
FT                   -> EMBL4 43000bp"
FT   misc_feature    0..0
FT                   /note="sequence to the left and right of polylinker"
FT   misc_binding    0..0
FT                   /note="MCS double SalI-BamHI-EcoRI-EcoRI-BamHI-SalI
FT                   ggatctgggtcgacctgcaggtcaacggatccgttgacctgcaggtcgac
FT                   ccagatctgggtcgaccggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI-EcoRI, left and right arms,
FT                   ggatctgggtcgacctgcaggtcaacg gatccgttgacctgcaggtcgac
FT                   ccagatctgggtcgaccggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_feature    0..0
FT                   /note="lambda 2001 stuffer fragment (13700 bp)"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda red+"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda gam+"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SstI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda Spi+ reporter gene"
SQ   Sequence 20067 BP; 4571 A; 5055 C; 6319 G; 4122 T; 0 other;
     gggcggcgac ctcgcgggtt ttcgctattt atgaaaattt tccggtttaa ggcgtttccg
     ttcttcttcg tcataactta atgtttttat ttaaaatacc ctctgaaaag aaaggaaacg
     acaggtgctg aaagcgaggc tttttggcct ctgtcgtttc ctttctctgt ttttgtccgt
     ggaatgaaca atggaagtca acaaaaagca gctggctgac attttcggtg cgagtatccg
     taccattcag aactggcagg aacagggaat gcccgttctg cgaggcggtg gcaagggtaa
     tgaggtgctt tatgactctg ccgccgtcat aaaatggtat gccgaaaggg atgctgaaat
     tgagaacgaa aagctgcgcc gggaggttga agaactgcgg caggccagcg aggcagatct
     ccagccagga actattgagt acgaacgcca tcgacttacg cgtgcgcagg ccgacgcaca
     ggaactgaag aatgccagag actccgctga agtggtggaa accgcattct gtactttcgt
     gctgtcgcgg atcgcaggtg aaattgccag tattctcgac gggctccccc tgtcggtgca
     gcggcgtttt ccggaactgg aaaaccgaca tgttgatttc ctgaaacggg atatcatcaa
     agccatgaac aaagcagccg cgctggatga actgataccg gggttgctga gtgaatatat
     cgaacagtca ggttaacagg ctgcggcatt ttgtccgcgc cgggcttcgc tcactgttca
     ggccggagcc acagaccgcc gttgaatggg cggatgctaa ttactatctc ccgaaagaat
     ccgcatacca ggaagggcgc tgggaaacac tgccctttca gcgggccatc atgaatgcga
     tgggcagcga ctacatccgt gaggtgaatg tggtgaagtc tgcccgtgtc ggttattcca
     aaatgctgct gggtgtttat gcctacttta tagagcataa gcagcgcaac acccttatct
     ggttgccgac ggatggtgat gccgagaact ttatgaaaac ccacgttgag ccgactattc
     gtgatattcc gtcgctgctg gcgctggccc cgtggtatgg caaaaagcac cgggataaca
     cgctcaccat gaagcgtttc actaatgggc gtggcttctg gtgcctgggc ggtaaagcgg
     caaaaaacta ccgtgaaaag tcggtggatg tggcgggtta tgatgaactt gctgcttttg
     atgatgatat tgaacaggaa ggctctccga cgttcctggg tgacaagcgt attgaaggct
     cggtctggcc aaagtccatc cgtggctcca cgccaaaagt gagaggcacc tgtcagattg
     agcgtgcagc cagtgaatcc ccgcatttta tgcgttttca tgttgcctgc ccgcattgcg
     gggaggagca gtatcttaaa tttggcgaca aagagacgcc gtttggcctc aaatggacgc
     cggatgaccc ctccagcgtg ttttatctct gcgagcataa tgcctgcgtc atccgccagc
     aggagctgga ctttactgat gcccgttata tctgcgaaaa gaccgggatc tggacccgtg
     atggcattct ctggttttcg tcatccggtg aagagattga gccacctgac agtgtgacct
     ttcacatctg gacagcgtac agcccgttca ccacctgggt gcagattgtc aaagactgga
     tgaaaacgaa aggggatacg ggaaaacgta aaaccttcgt aaacaccacg ctcggtgaga
     cgtgggaggc gaaaattggc gaacgtccgg atgctgaagt gatggcagag cggaaagagc
     attattcagc gcccgttcct gaccgtgtgg cttacctgac cgccggtatc gactcccagc
     tggaccgcta cgaaatgcgc gtatggggat gggggccggg tgaggaaagc tggctgattg
     accggcagat tattatgggc cgccacgacg atgaacagac gctgctgcgt gtggatgagg
     ccatcaataa aacctatacc cgccggaatg gtgcagaaat gtcgatatcc cgtatctgct
     gggatactgg cgggattgac ccgaccattg tgtatgaacg ctcgaaaaaa catgggctgt
     tccgggtgat ccccattaaa ggggcatccg tctacggaaa gccggtggcc agcatgccac
     gtaagcgaaa caaaaacggg gtttacctta ccgaaatcgg tacggatacc gcgaaagagc
     agatttataa ccgcttcaca ctgacgccgg aaggggatga accgcttccc ggtgccgttc
     acttcccgaa taacccggat atttttgatc tgaccgaagc gcagcagctg actgctgaag
     agcaggtcga aaaatgggtg gatggcagga aaaaaatact gtgggacagc aaaaagcgac
     gcaatgaggc actcgactgc ttcgtttatg cgctggcggc gctgcgcatc agtatttccc
     gctggcagct ggatctcagt gcgctgctgg cgagcctgca ggaagaggat ggtgcagcaa
     ccaacaagaa aacactggca gattacgccc gtgccttatc cggagaggat gaatgacgcg
     acaggaagaa cttgccgctg cccgtgcggc actgcatgac ctgatgacag gtaaacgggt
     ggcaacagta cagaaagacg gacgaagggt ggagtttacg gccacttccg tgtctgacct
     gaaaaaatat attgcagagc tggaagtgca gaccggcatg acacagcgac gcaggggacc
     tgcaggattt tatgtatgaa aacgcccacc attcccaccc ttctggggcc ggacggcatg
     acatcgctgc gcgaatatgc cggttatcac ggcggtggca gcggatttgg agggcagttg
     cggtcgtgga acccaccgag tgaaagtgtg gatgcagccc tgttgcccaa ctttacccgt
     ggcaatgccc gcgcagacga tctggtacgc aataacggct atgccgccaa cgccatccag
     ctgcatcagg atcatatcgt cgggtctttt ttccggctca gtcatcgccc aagctggcgc
     tatctgggca tcggggagga agaagcccgt gccttttccc gcgaggttga agcggcatgg
     aaagagtttg ccgaggatga ctgctgctgc attgacgttg agcgaaaacg cacgtttacc
     atgatgattc gggaaggtgt ggccatgcac gcctttaacg gtgaactgtt cgttcaggcc
     acctgggata ccagttcgtc gcggcttttc cggacacagt tccggatggt cagcccgaag
     cgcatcagca acccgaacaa taccggcgac agccggaact gccgtgccgg tgtgcagatt
     aatgacagcg gtgcggcgct gggatattac gtcagcgagg acgggtatcc tggctggatg
     ccgcagaaat ggacatggat accccgtgag ttacccggcg ggcgcgcctc gttcattcac
     gtttttgaac ccgtggagga cgggcagact cgcggtgcaa atgtgtttta cagcgtgatg
     gagcagatga agatgctcga cacgctgcag aacacgcagc tgcagagcgc cattgtgaag
     gcgatgtatg ccgccaccat tgagagtgag ctggatacgc agtcagcgat ggattttatt
     ctgggcgcga acagtcagga gcagcgggaa aggctgaccg gctggattgg tgaaattgcc
     gcgtattacg ccgcagcgcc ggtccggctg ggaggcgcaa aagtaccgca cctgatgccg
     ggtgactcac tgaacctgca gacggctcag gatacggata acggctactc cgtgtttgag
     cagtcactgc tgcggtatat cgctgccggg ctgggtgtct cgtatgagca gctttcccgg
     aattacgccc agatgagcta ctccacggca cgggccagtg cgaacgagtc gtgggcgtac
     tttatggggc ggcgaaaatt cgtcgcatcc cgtcaggcga gccagatgtt tctgtgctgg
     ctggaagagg ccatcgttcg ccgcgtggtg acgttacctt caaaagcgcg cttcagtttt
     caggaagccc gcagtgcctg ggggaactgc gactggatag gctccggtcg tatggccatc
     gatggtctga aagaagttca ggaagcggtg atgctgatag aagccggact gagtacctac
     gagaaagagt gcgcaaaacg cggtgacgac tatcaggaaa tttttgccca gcaggtccgt
     gaaacgatgg agcgccgtgc agccggtctt aaaccgcccg cctgggcggc tgcagcattt
     gaatccgggc tgcgacaatc aacagaggag gagaagagtg acagcagagc tgcgtaatct
     cccgcatatt gccagcatgg cctttaatga gccgctgatg cttgaacccg cctatgcgcg
     ggttttcttt tgtgcgcttg caggccagct tgggatcagc agcctgacgg atgcggtgtc
     cggcgacagc ctgactgccc aggaggcact cgcgacgctg gcattatccg gtgatgatga
     cggaccacga caggcccgca gttatcaggt catgaacggc atcgccgtgc tgccggtgtc
     cggcacgctg gtcagccgga cgcgggcgct gcagccgtac tcggggatga ccggttacaa
     cggcattatc gcccgtctgc aacaggctgc cagcgatccg atggtggacg gcattctgct
     cgatatggac acgcccggcg ggatggtggc gggggcattt gactgcgctg acatcatcgc
     ccgtgtgcgt gacataaaac cggtatgggc gcttgccaac gacatgaact gcagtgcagg
     tcagttgctt gccagtgccg cctcccggcg tctggtcacg cagaccgccc ggacaggctc
     catcggcgtc atgatggctc acagtaatta cggtgctgcg ctggagaaac agggtgtgga
     aatcacgctg atttacagcg gcagccataa ggtggatggc aacccctaca gccatcttcc
     ggatgacgtc cgggagacac tgcagtcccg gatggacgca acccgccaga tgtttgcgca
     gaaggtgtcg gcatataccg gcctgtccgt gcaggttgtg ctggataccg aggctgcagt
     gtacagcggt caggaggcca ttgatgccgg actggctgat gaacttgtta acagcaccga
     tgcgatcacc gtcatgcgtg atgcactgga tgcacgtaaa tcccgtctct caggagggcg
     aatgaccaaa gagactcaat caacaactgt ttcagccact gcttcgcagg ctgacgttac
     tgacgtggtg ccagcgacgg agggcgagaa cgccagcgcg gcgcagccgg acgtgaacgc
     gcagatcacc gcagcggttg cggcagaaaa cagccgcatt atggcgatcc tcaactgtga
     ggaggctcac ggacgcgaag aacaggcacg cgtgctggca gaaacccccg gtatgaccgt
     gaaaacggcc cgccgcattc tggccgcagc accacagagt gcacaggcgc gcagtgacac
     tgcgctggat cgtctgatgc agggggcacc ggcaccgctg gctgcaggta acccggcatc
     tgatgccgtt aacgatttgc tgaacacacc agtgtaaggg atgtttatga cgagcaaaga
     aacctttacc cattaccagc cgcagggcaa cagtgacccg gctcataccg caaccgcgcc
     cggcggattg agtgcgaaag cgcctgcaat gaccccgctg atgctggaca cctccagccg
     taagctggtt gcgtgggatg gcaccaccga cggtgctgcc gttggcattc ttgcggttgc
     tgctgaccag accagcacca cgctgacgtt ctacaagtcc ggcacgttcc gttatgagga
     tgtgctctgg ccggaggctg ccagcgacga gacgaaaaaa cggaccgcgt ttgccggaac
     ggcaatcagc atcgtttaac tttacccttc atcactaaag gccgcctgtg cggctttttt
     tacgggattt ttttatgtcg atgtacacaa ccgcccaact gctggcggca aatgagcaga
     aatttaagtt tgatccgctg tttctgcgtc tctttttccg tgagagctat cccttcacca
     cggagaaagt ctatctctca caaattccgg gactggtaaa catggcgctg tacgtttcgc
     cgattgtttc cggtgaggtt atccgttccc gtggcggctc cacctctgaa tttacgccgg
     gatatgtcaa gccgaagcat gaagtgaatc cgcagatgac cctgcgtcgc ctgccggatg
     aagatccgca gaatctggcg gacccggctt accgccgccg tcgcatcatc atgcagaaca
     tgcgtgacga agagctggcc attgctcagg tcgaagagat gcaggcagtt tctgccgtgc
     ttaagggcaa atacaccatg accggtgaag ccttcgatcc ggttgaggtg gatatgggcc
     gcagtgagga gaataacatc acgcagtccg gcggcacgga gtggagcaag cgtgacaagt
     ccacgtatga cccgaccgac gatatcgaag cctacgcgct gaacgccagc ggtgtggtga
     atatcatcgt gttcgatccg aaaggctggg cgctgttccg ttccttcaaa gccgtcaagg
     agaagctgga tacccgtcgt ggctctaatt ccgagctgga gacagcggtg aaagacctgg
     gcaaagcggt gtcctataag gggatgtatg gcgatgtggc catcgtcgtg tattccggac
     agtacgtgga aaacggcgtc aaaaagaact tcctgccgga caacacgatg gtgctgggga
     acactcaggc acgcggtctg cgcacctatg gctgcattca ggatgcggac gcacagcgcg
     aaggcattaa cgcctctgcc cgttacccga aaaactgggt gaccaccggc gatccggcgc
     gtgagttcac catgattcag tcagcaccgc tgatgctgct ggctgaccct gatgagttcg
     tgtccgtaca actggcgtaa tcatggccct tcggggccat tgtttctctg tggaggagtc
     catgacgaaa gatgaactga ttgcccgtct ccgctcgctg ggtgaacaac tgaaccgtga
     tgtcagcctg acggggacga aagaagaact ggcgctccgt gtggcagagc tgaaagagga
     gcttgatgac acggatgaaa ctgccggtca ggacacccct ctcagccggg aaaatgtgct
     gaccggacat gaaaatgagg tgggatcagc gcagccggat accgtgattc tggatacgtc
     tgaactggtc acggtcgtgg cactggtgaa gctgcatact gatgcacttc acgccacgcg
     ggatgaacct gtggcatttg tgctgccggg aacggcgttt cgtgtctctg ccggtgtggc
     agccgaaatg acagagcgcg gcctggccag aatgcaataa cgggaggcgc tgtggctgat
     ttcgataacc tgttcgatgc tgccattgcc cgcgccgatg aaacgatacg cgggtacatg
     ggaacgtcag ccaccattac atccggtgag cagtcaggtg cggtgatacg tggtgttttt
     gatgaccctg aaaatatcag ctatgccgga cagggcgtgc gcgttgaagg ctccagcccg
     tccctgtttg tccggactga tgaggtgcgg cagctgcggc gtggagacac gctgaccatc
     ggtgaggaaa atttctgggt agatcgggtt tcgccggatg atggcggaag ttgtcatctc
     tggcttggac ggggcgtacc gcctgccgtt aaccgtcgcc gctgaaaggg ggatgtatgg
     ccataaaagg tcttgagcag gccgttgaaa acctcagccg tatcagcaaa acggcggtgc
     ctggtgccgc cgcaatggcc attaaccgcg ttgcttcatc cgcgatatcg cagtcggcgt
     cacaggttgc ccgtgagaca aaggtacgcc ggaaactggt aaaggaaagg gccaggctga
     aaagggccac ggtcaaaaat ccgcaggcca gaatcaaagt taaccggggg gatttgcccg
     taatcaagct gggtaatgcg cgggttgtcc tttcgcgccg caggcgtcgt aaaaaggggc
     agcgttcatc cctgaaaggt ggcggcagcg tgcttgtggt gggtaaccgt cgtattcccg
     gcgcgtttat tcagcaactg aaaaatggcc ggtggcatgt catgcagcgt gtggctggga
     aaaaccgtta ccccattgat gtggtgaaaa tcccgatggc ggtgccgctg accacggcgt
     ttaaacaaaa tattgagcgg atacggcgtg aacgtcttcc gaaagagctg ggctatgcgc
     tgcagcatca actgaggatg gtaataaagc gatgaaacat actgaactcc gtgcagccgt
     actggatgca ctggagaagc atgacaccgg ggcgacgttt tttgatggtc gccccgctgt
     ttttgatgag gcggattttc cggcagttgc cgtttatctc accggcgctg aatacacggg
     cgaagagctg gacagcgata cctggcaggc ggagctgcat atcgaagttt tcctgcctgc
     tcaggtgccg gattcagagc tggatgcgtg gatggagtcc cggatttatc cggtgatgag
     cgatatcccg gcactgtcag atttgatcac cagtatggtg gccagcggct atgactaccg
     gcgcgacgat gatgcgggct tgtggagttc agccgatctg acttatgtca ttacctatga
     aatgtgagga cgctatgcct gtaccaaatc ctacaatgcc ggtgaaaggt gccgggacca
     ccctgtgggt ttataagggg agcggtgacc cttacgcgaa tccgctttca gacgttgact
     ggtcgcgtct ggcaaaagtt aaagacctga cgcccggcga actgaccgct gagtcctatg
     acgacagcta tctcgatgat gaagatgcag actggactgc gaccgggcag gggcagaaat
     ctgccggaga taccagcttc acgctggcgt ggatgcccgg agagcagggg cagcaggcgc
     tgctggcgtg gtttaatgaa ggcgataccc gtgcctataa aatccgcttc ccgaacggca
     cggtcgatgt gttccgtggc tgggtcagca gtatcggtaa ggcggtgacg gcgaaggaag
     tgatcacccg cacggtgaaa gtcaccaatg tgggacgtcc gtcgatggca gaagatcgca
     gcacggtaac agcggcaacc ggcatgaccg tgacgcctgc cagcacctcg gtggtgaaag
     ggcagagcac cacgctgacc gtggccttcc agccggaggg cgtaaccgac aagagctttc
     gtgcggtgtc tgcggataaa acaaaagcca ccgtgtcggt cagtggtatg accatcaccg
     tgaacggcgt tgctgcaggc aaggtcaaca ttccggttgt atccggtaat ggtgagtttg
     ctgcggttgc agaaattacc gtcaccgcca gttaatccgg agagtcagcg atgttcctga
     aaaccgaatc atttgaacat aacggtgtga ccgtcacgct ttctgaactg tcagccctgc
     agcgcattga gcatctcgcc ctgatgaaac ggcaggcaga acaggcggag tcagacagca
     accggaagtt tactgtggaa gacgccatca gaaccggcgc gtttctggtg gcgatgtccc
     tgtggcataa ccatccgcag aagacgcaga tgccgtccat gaatgaagcc gttaaacaga
     ttgagcagga agtgcttacc acctggccca cggaggcaat ttctcatgct gaaaacgtgg
     tgtaccggct gtctggtatg tatgagtttg tggtgaataa tgcccctgaa cagacagagg
     acgccgggcc cgcagagcct gtttctgcgg gaaagtgttc gacggtgagc tgagttttgc
     cctgaaactg gcgcgtgaga tggggcgacc cgactggcgt gccatgcttg ccgggatgtc
     atccacggag tatgccgact ggcaccgctt ttacagtacc cattattttc atgatgttct
     gctggatatg cacttttccg ggctgacgta caccgtgctc agcctgtttt tcagcgatcc
     ggatatgcat ccgctggatt tcagtctgct gaaccggcgc gaggctgacg aagagcctga
     agatgatgtg ctgatgcaga aagcggcagg gcttgccgga ggtgtccgct ttggcccgga
     cgggaatgaa gttatccccg cttccccgga tgtggcggac atgacggagg atgacgtaat
     gctgatgaca gtatcagaag ggatcgcagg aggagtccgg tatggctgaa ccggtaggcg
     atctggtcgt tgatttgagt ctggatgcgg ccagatttga cgagcagatg gccagagtca
     ggcgtcattt ttctggtacg gaaagtgatg cgaaaaaaac agcggcagtc gttgaacagt
     cgctgagccg acaggcgctg gctgcacaga aagcggggat ttccgtcggg cagtataaag
     ccgccatgcg tatgctgcct gcacagttca ccgacgtggc cacgcagctt gcaggcgggc
     aaagtccgtg gctgatcctg ctgcaacagg gggggcaggt gaaggactcc ttcggcggga
     tgatccccat gttcaggggg cttgccggtg cgatcaccct gccgatggtg ggggccacct
     cgctggcggt ggcgaccggt gcgctggcgt atgcctggta tcagggcaac tcaaccctgt
     ccgatttcaa caaaacgctg gtcctttccg gcaatcaggc gggactgacg gcagatcgta
     tgctggtcct gtccagagcc gggcaggcgg cagggctgac gtttaaccag accagcgagt
     cactcagcgc actggttaag gcgggggtaa gcggtgaggc tcagattgcg tccatcagcc
     agagtgtggc gcgtttctcc tctgcatccg gcgtggaggt ggacaaggtc gctgaagcct
     tcgggaagct gaccacagac ccgacgtcgg ggctgacggc gatggctcgc cagttccata
     acgtgtcggc ggagcagatt gcgtatgttg ctcagttgca gcgttccggc gatgaagccg
     gggcattgca ggcggcgaac gaggccgcaa cgaaagggtt tgatgaccag acccgccgcc
     tgaaagagaa catgggcacg ctggagacct gggcagacag gactgcgcgg gcattcaaat
     ccatgtggga tgcggtgctg gatattggtc gtcctgatac cgcgcaggag atgctgatta
     aggcagaggc tgcgtataag aaagcagacg acatctggaa tctgcgcaag gatgattatt
     ttgttaacga tgaagcgcgg gcgcgttact gggatgatcg tgaaaaggcc cgtcttgcgc
     ttgaagccgc ccgaaagaag gctgagcagc agactcaaca ggacaaaaat gcgcagcagc
     agagcgatac cgaagcgtca cggctgaaat ataccgaaga ggcgcagaag gcttacgaac
     ggctgcagac gccgctggag aaatataccg cccgtcagga agaactgaac aaggcactga
     aagacgggaa aatcctgcag gcggattaca acacgctgat ggcggcggcg aaaaaggatt
     atgaagcgac gctgaaaaag ccgaaacagt ccagcgtgaa ggtgtctgcg ggcgatcgtc
     aggaagacag tgctcatgct gccctgctga cgcttcaggc agaactccgg acgctggaga
     agcatgccgg agcaaatgag aaaatcagcc agcagcgccg ggatttgtgg aaggcggaga
     gtcagttcgc ggtactggag gaggcggcgc aacgtcgcca gctgtctgca caggagaaat
     ccctgctggc gcataaagat gagacgctgg agtacaaacg ccagctggct gcacttggcg
     acaaggttac gtatcaggag cgcctgaacg cgctggcgca gcaggcggat aaattcgcac
     agcagcaacg ggcaaaacgg gccgccattg atgcgaaaag ccgggggctg actgaccggc
     aggcagaacg ggaagccacg gaacagcgcc tgaaggaaca gtatggcgat aatccgctgg
     cgctgaataa cgtcatgtca gagcagaaaa agacctgggc ggctgaagac cagcttcgcg
     ggaactggat ggcaggcctg aagtccggct ggagtgagtg ggaagagagc gccacggaca
     gtatgtcgca ggtaaaaagt gcagccacgc agacctttga tggtattgca cagaatatgg
     cggcgatgct gaccggcagt gagcagaact ggcgcagctt cacccgttcc gtgctgtcca
     tgatgacaga aattctgctt aagcaggcaa tggtggggat tgtcgggagt atcggcagcg
     ccattggcgg ggctgttggt ggcggcgcat ccgcgtcagg cggtacagcc attcaggccg
     ctgcggcgaa attccatttt gcaaccggag gatttacggg aaccggcggc aaatatgagc
     cagcggggat tgttcaccgt ggtgagtttg tcttcacgaa ggaggcaacc agccggattg
     gcgtggggaa tctttaccgg ctgatgcgcg gctatgccac cggcggttat gtcggtacac
     cgggcagcat ggcagacagc cggtcgcagg cgtccgggac gtttgagcag aataaccatg
     tggtgattaa caacgacggc acgaacgggc agataggtcc ggctgctctg aaggcggtgt
     atgacatggc ccgcaagggt gcccgtgatg aaattcagac acagatgcgt gatggtggcc
     tgttctccgg aggtggacga tgaagacctt ccgctggaaa gtgaaacccg gtatggatgt
     ggcttcggtc ccttctgtaa gaaaggtgcg ctttggtgat ggctattctc agcgagcgcc
     tgccgggctg aatgccaacc tgaaaacgta cagcgtgacg ctttctgtcc cccgtgagga
     ggccacggta ctggagtcgt ttctggaaga gcacgggggc tggaaatcct ttctgtggac
     gccgccttat gagtggcggc agataaaggt gacctgcgca aaatggtcgt cgcgggtcag
     tatgctgcgt gttgagttca gcgcagagtt tgaacaggtg gtgaactgat gcaggatatc
     cggcaggaaa cactgaatga atgcacccgt gcggagcagt cggccagcgt ggtgctctgg
     gaaatcgacc tgacagaggt cggtggagaa cgttattttt tctgtaatga gcagaacgaa
     aaaggtgagc cggtcacctg gcaggggcga cagtatcagc cgtatcccat tcaggggagc
     ggttttgaac tgaatggcaa aggcaccagt acgcgcccca cgctgacggt ttctaacctg
     tacggtatgg tcaccgggat ggcggaagat atgcagagtc tggtcggcgg aacggtggtc
     cggcgtaagg tttacgcccg ttttctggat gcggtgaact tcgtcaacgg aaacagttac
     gccgatccgg agcaggaggt gatcagccgc tggcgcattg agcagtgcag cgaactgagc
     gcggtgagtg cctcctttgt actgtccacg ccgacggaaa cggatggcgc tgtttttccg
     ggacgtatca tgctggccaa cacctgcacc tggacctatc gcggtgacga gtgcggttat
     agcggtccgg ctgtcgcgga tgaatatgac cagccaacgt ccgatatcac gaaggataaa
     tgcagcaaat gcctgagcgg ttgtaagttc cgcaataacg tcggcaactt tggcggcttc
     ctttccatta acaaactttc gcagtaaatc ccatgacaca gacagaatca gcgattctgg
     cgcacgcccg gcgatgtgcg ccagcggagt cgtgcggctt cgtggtaagc acgccggagg
     gggaaagata tttcccctgc gtgaatatct ccggtgagcc ggaggctatt tccgtatgtc
     gccggaagac tggctgcagg cagaaatgca gggtgagatt gtggcgctgg tccacagcca
     ccccggtggt ctgccctggc tgagtgaggc cgaccggcgg ctgcaggtgc agagtgattt
     gccgtggtgg ctggtctgcc gggggacgat tcataagttc cgctgtgtgc cgcatctcac
     cgggcggcgc tttgagcacg gtgtgacgga ctgttacaca ctgttccggg atgcttatca
     tctggcgggg attgagatgc cggactttca tcgtgaggat gactggtggc gtaacggcca
     gaatctctat ctggataatc tggaggcgac ggggctgtat caggtgccgt tgtcagcggc
     acagccgggc gatgtgctgc tgtgctgttt tggttcatca gtgccgaatc acgccgcaat
     ttactgcggc gacggcgagc tgctgcacca tattcctgaa caactgagca aacgagagag
     gtacaccgac aaatggcagc gacgcacaca ctccctctgg cgtcaccggg catggcgcgc
     atctgccttt acggggattt acaacgattt ggtcgccgca tcgaccttcg tgtgaaaacg
     ggggctgaag ccatccgggc actggccaca cagctcccgg cgtttcgtca gaaactgagc
     gacggctggt atcaggtacg gattgccggg cgggacgtca gcacgtccgg gttaacggcg
     cagttacatg agactctgcc tgatggcgct gtaattcata ttgttcccag agtcgccggg
     gccaagtcag gtggcgtatt ccagattgtc ctgggggctg ccgccattgc cggatcattc
     tttaccgccg gagccaccct tgcagcatgg ggggcagcca ttggggccgg tggtatgacc
     ggcatcctgt tttctctcgg tgccagtatg gtgctcggtg gtgtggcgca gatgctggca
     ccgaaagcca gaactccccg tatacagaca acggataacg gtaagcagaa cacctatttc
     tcctcactgg ataacatggt tgcccagggc aatgttctgc ctgttctgta cggggaaatg
     cgcgtggggt cacgcgtggt ttctcaggag atcagcacgg cagacgaagg ggacggtggt
     caggttgtgg tgattggtcg ctgatgcaaa atgttttatg tgaaaccgcc tgcgggcggt
     tttgtcattt atggagcgtg aggaatgggt aaaggaagca gtaaggggca taccccgcgc
     gaagcgaagg acaacctgaa gtccacgcag ttgctgagtg tgatcgatgc catcagcgaa
     gggccgattg aaggtccggt ggatggctta aaaagcgtgc tgctgaacag tacgccggtg
     ctggacactg aggggaatac caacatatcc ggtgtcacgg tggtgttccg ggctggtgag
     caggagcaga ctccgccgga gggatttgaa tcctccggct ccgagacggt gctgggtacg
     gaagtgaaat atgacacgcc gatcacccgc accattacgt ctgcaaacat cgaccgtctg
     cgctttacct tcggtgtaca ggcactggtg gaaaccacct caaagggtga caggaatccg
     tcggaagtcc gcctgctggt tcagatacaa cgtaacggtg gctgggtgac ggaaaaagac
     atcaccatta agggcaaaac cacctcgcag tatctggcct cggtggtgat gggtaacctg
     ccgccgcgcc cgtttaatat ccggatgcgc aggatgacgc cggacagcac cacagaccag
     ctgcagaaca aaacgctctg gtcgtcatac actgaaatca tcgatgtgaa acagtgctac
     ccgaacacgg cactggtcgg cgtgcaggtg gactcggagc agttcggcag ccagcaggtg
     agccgtaatt atcatctgcg cgggcgtatt ctgcaggtgc cgtcgaacta taacccgcag
     acgcggcaat acagcggtat ctgggacgga acgtttaaac cggcatacag caacaacatg
     gcctggtgtc tgtgggatat gctgacccat ccgcgctacg gcatggggaa acgtcttggt
     gcggcggatg tggataaatg ggcgctgtat gtcatcggcc agtactgcga ccagtcagtg
     ccggacggct ttggcggcac ggagccgcgc atcacctgta atgcgtacct gaccacacag
     cgtaaggcgt gggatgtgct cagcgatttc tgctcggcga tgcgctgtat gccggtatgg
     aacgggcaga cgctgacgtt cgtgcaggac cgaccgtcgg ataagacgtg gacctataac
     cgcagtaatg tggtgatgcc ggatgatggc gcgccgttcc gctacagctt cagcgccctg
     aaggaccgcc ataatgccgt tgaggtgaac tggattgacc cgaacaacgg ctgggagacg
     gcgacagagc ttgttgaaga tacgcaggcc attgcccgtt acggtcgtaa tgttacgaag
     atggatgcct ttggctgtac cagccggggg caggcacacc gcgccgggct gtggctgatt
     aaaacagaac tgctggaaac gcagaccgtg gatttcagcg tcggcgcaga agggcttcgc
     catgtaccgg gcgatgttat tgaaatctgc gatgatgact atgccggtat cagcaccggt
     ggtcgtgtgc tggcggtgaa cagccagacc cggacgctga cgctcgaccg tgaaatcacg
     ctgccatcct ccggtaccgc gctgataagc ctggttgacg gaagtggcaa tccggtcagc
     gtggaggttc agtccgtcac cgacggcgtg aaggtaaaag tgagccgtgt tcctgacggt
     gttgctgaat acagcgtatg ggagctgaag ctgccgacgc tgcgccagcg actgttccgc
     tgcgtgagta tccgtgagaa cgacgacggc acgtatgcca tcaccgccgt gcagcatgtg
     ccggaaaaag aggccatcgt ggataacggg gcgcactttg acggcgaaca gagtggcacg
     gtgaatggtg tcacgccgcc agcggtgcag cacctgaccg cagaagtcac tgcagacagc
     ggggaatatc aggtgctggc gcgatgggac acaccgaagg tggtgaaggg cgtgagtttc
     ctgctccgtc tgaccgtaac agcggacgac ggcagtgagc ggctggtcag cacggcccgg
     acgacggaaa ccacataccg cttcacgcaa ctggcgctgg ggaactacag gctgacagtc
     cgggcggtaa atgcgtgggg gcagcagggc gatccggcgt cggtatcgtt ccggattgcc
     gcaccggcag caccgtcgag gattgagctg acgccgggct attttcagat aaccgccacg
     ccgcatcttg ccgtttatga cccgacggta cagtttgagt tctggttctc ggaaaagcag
     attgcggata tcagacaggt tgaaaccagc acgcgttatc ttggtacggc gctgtactgg
     atagccgcca gtatcaatat caaaccgggc catgattatt acttttatat ccgcagtgtg
     aacaccgttg gcaaatcggc attcgtggag gccgtcggtc gggcgagcga tgatgcggaa
     ggttacctgg attttttcaa aggcaagata accgaatccc atctcggcaa ggagctgctg
     gaaaaagtcg agctgacgga ggataacgcc agcagactgg aggagttttc gaaagagtgg
     aaggatgcca gtgataagtg gaatgccatg tgggctgtca aaattgagca gaccaaagac
     ggcaaacatt atgtcgcggg tattggcctc agcatggagg acacggagga aggcaaactg
     agccagtttc tggttgccgc caatcgtatc gcatttattg acccggcaaa cgggaatgaa
     acgccgatgt ttgtggcgca gggcaaccag atattcatga acgacgtgtt cctgaagcgc
     ctgacggccc ccaccattac cagcggcggc aatcctccgg ccttttccct gacaccggac
     ggaaagctga ccgctaaaaa tgcggatatc agtggcagtg tgaatgcgaa ctccgggacg
     ctcagtaatg tgacgatagc tgaaaactgt acgataaacg gtacgctgag ggcggaaaaa
     atcgtcgggg acattgtaaa ggcggcgagc gcggcttttc cgcgccagcg tgaaagcagt
     gtggactggc cgtcaggtac ccgtactgtc accgtgaccg atgaccatcc ttttgatcgc
     cagatagtgg tgcttccgct gacgtttcgc ggaagtaagc gtactgtcag cggcaggaca
     acgtattcga tgtgttatct gaaagtactg atgaacggtg cggtgattta tgatggcgcg
     gcgaacgagg cggtacaggt gttctcccgt attgttgaca tgccagcggg tcggggaaac
     gtgatcctga cgttcacgct tacgtccaca cggcattcgg cagatattcc gccgtatacg
     tttgccagcg atgtgcaggt tatggtgatt aagaaacagg cgctgggcat cagcgtggtc
     tgagtgtgtt acagaggttc gtccgggaac gggcgtttta ttataaaaca gtgagaggtg
     aacgatgcgt aatgtgtgta ttgccgttgc tgtctttgcc gcacttgcgg tgacagtcac
     tccggcccgt gcggaaggtg gacatggtac gtttacggtg ggctattttc aagtgaaacc
     gggtacattg ccgtcgttgt cgggcgggga taccggtgtg agtcatctga aagggattaa
     cgtgaagtac cgttatgagc tgacggacag tgtgggggtg atggcttccc tggggttcgc
     cgcgtcgaaa aagagcagca cagtgatgac cggggaggat acgtttcact atgagagcct
     gcgtggacgt tatgtgagcg tgatggccgg accggtttta caaatcagta agcaggtcag
     tgcgtacgcc atggccggag tggctcacag tcggtggtcc ggcagtacaa tggattaccg
     taagacggaa atcactcccg ggtatatgaa agagacgacc actgccaggg acgaaagtgc
     aatgcggcat acctcagtgg cgtggagtgc aggtatacag attaatccgg cagcgtccgt
     cgttgttgat attgcttatg aaggctccgg cagtggcgac tggcgtactg acggattcat
     cgttggggtc ggttataaat tctgattagc caggtaacac agtgttatga cagcccgccg
     gaaccggtgg gcttttttgt ggggtgaata tggcagtaaa gatttcagga gtcctgaaag
     acggcacagg aaaaccggta cagaactgca ccattcagct gaaagccaga cgtaacagca
     ccacggtggt ggtgaacacg gtgggctcag agaatccgga tgaagccgct tttttatact
     aagttggcat tataaaaaag cattgcttat caatttgttg caacgaacag gtcactatca
     gtcaaaataa aatcattatt tgatttcaat tttgtcccac tccctgcctc tgtcatcacg
     atactgtgat gccatggtgt ccgacttatg cccgagaaga tgttgagcaa acttatcgct
     tatctgcttc tcatagagtc ttgcagacaa actgcgcaac tcgtgaaagg taggcggatc
     tgggtcgacc tgcaggtcaa cggatcc