back Return to this vector's summary.
ID   EMBL3RTARM preliminary; circular DNA; SYN; 9170 BP.
XX
AC   U02425; U02453; X58667; X58668; X06780; IG1003; ATCC37266;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector lambda EMBL3 right arm - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   EMBL1 from lambda 1059 & pBR322
RC   EMBL2 from EMBL1
RC   EMBL2Sal, EMBL2RI from EMBL2
RC   [pUC2 from M13mp2]
RC   pUC(S-Bg), pUC(R-Bg) from pUC2
RC   EMBL3 from EMBL2Sal & EMBL2RI & pUC(S-Bg)
RC   EMBL4 from EMBL2Sal & EMBL2RI & pUC(R-Bg)
RC   EMBL3AamBam, EMBL3Sam7, EMBL3Aam, EMBL3Bam from EMBL3
RC   EMBL3AamSam, EMBL3BamSam from EMBL3
RA   Frischauf A.M., Lehrach H., Poustka A., Murray N.E.;
RT   "Lambda replacement vectors carrying polylinker sequences";
RL   J. Mol. Biol. 170:827-842(1983).
XX
RN   [2]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Goedert M., Rogers J., Wilson P.W.;
RT   ;
RL   Submitted (08-FEB-1988) to GenBank by:
RL   Goedert M., Rogers J., Wilson P.W.,
RL   Department of Physiology, University of Cambridge, Downing Street,
RL   Cambridge CB2 3EG, UNITED KINGDOM.
XX
RN   [3]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Schulman A.H.;
RT   ;
RL   Submitted (27-MAR-1991) to GenBank by:
RL   Schulman A.H., Institute of Biotechnology, University of Helsinki,
RL   Karvaamokuja 3, SF-00380 Helsinki, FINLAND.
XX
RN   [4]
RP   1-20067, 1-9170
RC   EMBL3 right/left arm
RA   Kitts P.A.;
RT   "CLONTECH Vectors On Disc version 1.1";
RL   Unpublished (1993).
XX
RN   [5]
RP   1-20067, 1-9170
RC   EMBL3 right/left arm
RA   Kitts P.A.;
RT   ;
RL   Submitted (07-OCT-1993) by:
RL   Kitts P.A., CLONTECH Laboratories, Inc.,
RL   4030 Fabian Way, Palo Alto, CA 94303, USA.
XX
CC   EMBL3 size is between 43000 and 44000 bp.
CC   left arm is 19300. right arm is 9200 bp. The stuffer is 14000 bp.
CC   Phage with inserts have the Spi- phenotype. [3]
CC   lambdaEMBL3 (ATCC 37266) and lambdaEMBL4 (ATCC 37267) differ only in
CC   the orientation of the MCS surrounding the stuffer fragment.
CC   Medium is 1592 SM buffer.
CC   This sequence has been compiled from information in the sequence
CC   databases, published literature and other sources; this vector has
CC   not been completely sequenced. If you suspect there is an error in
CC   this sequence, please contact CLONTECH's Technical Service
CC   Department at (415) 424-8222 or (800) 662-2566, extension 3 or
CC   E-mail CLONTECH@BIOTECHNET.COM.
CC   NCBI gi: 413791
CC   NCBI gi: 413819
CC   NM (lambda EMBL3)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)(linear)
CC   ST ()
CC   TY (phage)
CC   SP (CLONTECH)(Promega)(Stratagene)(ATCC)
CC   HO (E.coli LE392)(E.coli O358)(E.coli O359)(E.coli K803)
CC   HO (E.coli NM538)(E.coli NM539)(E.coli KW251)
CC   HO (E.coli XL-1-Blue MRA)(E.coli XL-1-Blue MRA P2)
CC   CP ()
CC   FN (cloning 8000-23000 bp)(chromosome walking)
CC   SE ()
CC   PA (lambda 1059)
CC   BR (EMBL4)
CC   OF ()
CC   OR (E.coli Y1090)
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. lambda 1059 remove middle HindIII-HindIII
FT                   \ 21011bp, lambda 23131..44142/27491bp
FT                   \ lambda 23131 25158 27480 36896 37460 44142
FT                   2. E. coli HindIII-HindIII 5700bp, trpE gene
FT                   -> EMBL1 33200bp
FT                   1. EMBL1 EcoRI, lambda 21227
FT                   \ lambda 21227 26105 31748 39169 44973
FT                   mutation
FT                   EcoRI, lambda 44973
FT                   mutation
FT                   -> EMBL2 33200bp [no EcoRI]
FT                   1. M13mp2, MCS
FT                   -> pUC2
FT                   1. pUC2 EcoRI 2200bp, pUC4 327 or 369
FT                   EcoRI-BglII-EcoRI linker 18bp gaattcagatctgaattc
FT                   EcoRI-EcoRI
FT                   -> pUC(R-Bg) 2200bp [EcoRI-BglII-EcoRI]
FT                   1. pUC2 SalI 2200bp, pUC4 342 or 354
FT                   SalI-BglII-SalI linker 18bp gtcgacagatctgtcgac
FT                   SalI-SalI
FT                   -> pUC(S-Bg) 2200bp
FT                   \ [EcoRI-BamHI-SalI-BglII-SalI-BamHI-EcoRI]
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(R-Bg) BglII 2200bp
FT                   -> EMBLRI
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(S-Bg) BglII 2200bp
FT                   -> EMBLSal
FT                   1. EMBLRI remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage
FT                   1. EMBLSal remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage2
FT                   1. EMBLRI middle EcoRI-EcoRI 2200bp
FT                   2. phage2 remove middle EcoRI-EcoRI, 27000bp
FT                   -> EMBL3 29237bp
FT                   1. EMBLSal middle EcoRI-EcoRI 2200bp
FT                   2. phage remove middle EcoRI-EcoRI, 40800bp
FT                   -> EMBL4 43000bp"
FT   misc_feature    0..0
FT                   /note="sequence to the left and right of polylinker"
FT   misc_binding    0..0
FT                   /note="MCS double SalI-BamHI-EcoRI-EcoRI-BamHI-SalI
FT                   ggatctgggtcgacctgcaggtcaacggatccgttgacctgcaggtcgac
FT                   ccagatctgggtcgaccggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI-EcoRI, left and right arms,
FT                   ggatctgggtcgacctgcaggtcaacg gatccgttgacctgcaggtcgac
FT                   ccagatctgggtcgaccggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_feature    0..0
FT                   /note="lambda 2001 stuffer fragment (13700 bp)"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda red+"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda gam+"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SstI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda Spi+ reporter gene"
XX
SQ   Sequence 9170 BP; 2534 A; 1996 C; 2251 G; 2389 T; 0 other;
     ggatccgttg acctgcaggt cgacccagat ctgggtcgac cggtcgaccc agatccactc
     gttattctcg gacgagtgtt cagtaatgaa cctctggaga gaaccatgta tatgatcgtt
     atctgggttg gacttctgct tttaagccca gataactggc ctgaatatgt taatgagaga
     atcggtattc ctcatgtgtg gcatgttttc gtctttgctc ttgcattttc gctagcaatt
     aatgtgcatc gattatcagc tattgccagc gccagatata agcgatttaa gctaagaaaa
     cgcattaaga tgcaaaacga taaagtgcga tcagtaattc aaaaccttac agaagagcaa
     tctatggttt tgtgcgcagc ccttaatgaa ggcaggaagt atgtggttac atcaaaacaa
     ttcccataca ttagtgagtt gattgagctt ggtgtgttga acaaaacttt ttcccgatgg
     aatggaaagc atatattatt ccctattgag gatatttact ggactgaatt agttgccagc
     tatgatccat ataatattga gataaagcca aggccaatat ctaagtaact agataagagg
     aatcgatttt cccttaattt tctggcgtcc actgcatgtt atgccgcgtt cgccaggctt
     gctgtaccat gtgcgctgat tcttgcgctc aatacgttgc aggttgcttt caatctgttt
     gtggtattca gccagcactg taaggtctat cggatttagt gcgctttcta ctcgtgattt
     cggtttgcga ttcagcgaga gaatagggcg gttaactggt tttgcgctta ccccaaccaa
     caggggattt gctgctttcc attgagcctg tttctctgcg cgacgttcgc ggcggcgtgt
     ttgtgcatcc atctggattc tcctgtcagt tagctttggt ggtgtgtggc agttgtagtc
     ctgaacgaaa accccccgcg attggcacat tggcagctaa tccggaatcg cacttacggc
     caatgcttcg tttcgtatca cacaccccaa agccttctgc tttgaatgct gcccttcttc
     agggcttaat ttttaagagc gtcaccttca tggtggtcag tgcgtcctgc tgatgtgctc
     agtatcaccg ccagtggtat ttatgtcaac accgccagag ataatttatc accgcagatg
     gttatctgta tgttttttat atgaatttat tttttgcagg ggggcattgt ttggtaggtg
     agagatctga attgctatgt ttagtgagtt gtatctattt atttttcaat aaatacaatt
     ggttatgtgt tttgggggcg atcgtgaggc aaagaaaacc cggcgctgag gccgggttat
     tcttgttctc tggtcaaatc ttttttgtgc tcatacgtta aatctatcac cgcaagggat
     aaatatctaa caccgtgcgt gttgactatt ttacctctgg cggtgataat ggttgcatgt
     actaaggagg ttgtatggaa caacgcataa ccctgaaaga ttatgcaatg cgctttgggc
     aaaccaagac agctaaagat ctcggcgtat atcaaagcgc gatcaacaag gccattcatg
     caggccgaaa gattttttta actataaacg ctgatggaag cgtttatgcg gaagaggtaa
     agcccttccc gagtaacaaa aaaacaacag cataaataac cccgctctta cacattccag
     ccctgaaaaa gggcatcaaa ttaaaccaca cctatggtgt atgcatttat ttgcatacat
     tcaatcaatt gttatctaag gaaatactta catatggttc gtgcaaacaa acgcaacgag
     gctctacgaa tcgagagtgc gttgcttaac aaaatcgcaa tgcttggaac tgagaagaca
     gcggaagctg tgggcgttga taagtcgcag atcagctggt ggaagaggga ctggattcca
     aagttctcaa tgctgcttgc tgttcttgaa tggggggtcg ttgacgacga catggctcga
     ttggcgcgac aagttgctgc gattctcacc aataaaaaac gcccggcggc aaccgagcgt
     tctgaacaaa tccagatgga gttctgaggt cattactgga tctatcaaca ggagtcatta
     tgacaaatac agcaaaaata ctcaacttcg gcagaggtaa ctttgccgga caggagcgta
     atgtggcaga tctcgatgat ggttacgcca gactatcaaa tatgctgctt gaggcttatt
     cgggcgcaga tctgaccaag cgacagttta aagtgctgct tgccattctg cgtaaaacct
     atgggtggaa taaaccaatg gacagaatca ccgattctca acttagcgag attacaaagt
     tacctgtcaa acggtgcaat gaagccaagt tagaactcgt cagaatgaat attatcaagc
     agcaaggcgg catgtttgga ccaaataaaa acatctcaga atggtgcatc cctcaaaacg
     agggaaaatc ccctaaaacg agggataaaa catccctcaa attgggggat tgctatccct
     caaaacaggg ggacacaaaa gacactatta caaaagaaaa aagaaaagat tattcgtcag
     agaactctgg cgaatcctct gaccagccag aaaacgacct ttctgtggtg aaaccggatg
     ctgcaattca gagcggcagc aagtggggga cagcagaaga cctgaccgcc gcagagtgga
     tgtttgacat ggtgaagact atcgcaccat cagccagaaa accgaatttt gctgggtggg
     ctaacgatat ccgcctgatg cgtgaacgtg acggacgtaa ccaccgcgac atgtgtgtgc
     tgttccgctg ggcatgccag gacaacttct ggtccggtaa cgtgctgagc ccggccaaac
     tccgcgataa gtggacccaa ctcgaaatca accgtaacaa gcaacaggca ggcgtgacag
     ccagcaaacc aaaactcgac ctgacaaaca cagactggat ttacggggtg gatctatgaa
     aaacatcgcc gcacagatgg ttaactttga ccgtgagcag atgcgtcgga tcgccaacaa
     catgccggaa cagtacgacg aaaagccgca ggtacagcag gtagcgcaga tcatcaacgg
     tgtgttcagc cagttactgg caactttccc ggcgagcctg gctaaccgtg accagaacga
     agtgaacgaa atccgtcgcc agtgggttct ggcttttcgg gaaaacggga tcaccacgat
     ggaacaggtt aacgcaggaa tgcgcgtagc ccgtcggcag aatcgaccat ttctgccatc
     acccgggcag tttgttgcat ggtgccggga agaagcatcc gttaccgccg gactgccaaa
     cgtcagcgag ctggttgata tggtttacga gtattgccgg aagcgaggcc tgtatccgga
     tgcggagtct tatccgtgga aatcaaacgc gcactactgg ctggttacca acctgtatca
     gaacatgcgg gccaatgcgc ttactgatgc ggaattacgc cgtaaggccg cagatgagct
     tgtccatatg actgcgagaa ttaaccgtgg tgaggcgatc cctgaaccag taaaacaact
     tcctgtcatg ggcggtagac ctctaaatcg tgcacaggct ctggcgaaga tcgcagaaat
     caaagctaag ttcggactga aaggagcaag tgtatgacgg gcaaagaggc aattattcat
     tacctgggga cgcataatag cttctgtgcg ccggacgttg ccgcgctaac aggcgcaaca
     gtaaccagca taaatcaggc cgcggctaaa atggcacggg caggtcttct ggttatcgaa
     ggtaaggtct ggcgaacggt gtattaccgg tttgctacca gggaagaacg ggaaggaaag
     atgagcacga acctgatgaa caaactggat acgattggat tcgacaacaa aaaagacctg
     cttatctcgg tgggcgattt ggttgatcgt ggtgcagaga acgttgaatg cctggaatta
     atcacattcc cctggttcag agctgtacgt ggaaaccatg agcaaatgat gattgatggc
     ttatcagagc gtggaaacgt taatcactgg ctgcttaatg gcggtggctg gttctttaat
     ctcgattacg acaaagaaat tctggctaaa gctcttgccc ataaagcaga tgaacttccg
     ttaatcatcg aactggtgag caaagataaa aaatatgtta tctgccacgc cgattatccc
     tttgacgaat acgagtttgg aaagccagtt gatcatcagc aggtaatctg gaaccgcgaa
     cgaatcagca actcacaaaa cgggatcgtg aaagaaatca aaggcgcgga cacgttcatc
     tttggtcata cgccagcagt gaaaccactc aagtttgcca accaaatgta tatcgatacc
     ggcgcagtgt tctgcggaaa cctaacattg attcaggtac agggagaagg cgcatgagac
     tcgaaagcgt agctaaattt cattcgccaa aaagcccgat gatgagcgac tcaccacggg
     ccacggcttc tgactctctt tccggtactg atgtgatggc tgctatgggg atggcgcaat
     cacaagccgg attcggtatg gctgcattct gcggtaagca cgaactcagc cagaacgaca
     aacaaaaggc tatcaactat ctgatgcaat ttgcacacaa ggtatcgggg aaataccgtg
     gtgtggcaaa gcttgaagga aatactaagg caaaggtact gcaagtgctc gcaacattcg
     cttatgcgga ttattgccgt agtgccgcga cgccgggggc aagatgcaga gattgccatg
     gtacaggccg tgcggttgat attgccaaaa cagagctgtg ggggagagtt gtcgagaaag
     agtgcggaag atgcaaaggc gtcggctatt caaggatgcc agcaagcgca gcatatcgcg
     ctgtgacgat gctaatccca aaccttaccc aacccacctg gtcacgcact gttaagccgc
     tgtatgacgc tctggtggtg caatgccaca aagaagagtc aatcgcagac aacattttga
     atgcggtcac acgttagcag catgattgcc acggatggca acatattaac ggcatgatat
     tgacttattg aataaaattg ggtaaatttg actcaacgat gggttaattc gctcgttgtg
     gtagtgagat gaaaagaggc ggcgcttact accgattccg cctagttggt cacttcgacg
     tatcgtctgg aactccaacc atcgcaggca gagaggtctg caaaatgcaa tcccgaaaca
     gttcgcaggt aatagttaga gcctgcataa cggtttcggg attttttata tctgcacaac
     aggtaagagc attgagtcga taatcgtgaa gagtcggcga gcctggttag ccagtgctct
     ttccgttgtg ctgaattaag cgaataccgg aagcagaacc ggatcaccaa atgcgtacag
     gcgtcatcgc cgcccagcaa cagcacaacc caaactgagc cgtagccact gtctgtcctg
     aactcattag taatagttac gctgcggcct tttacacatg accttcgtga aagcgggtgg
     caggaggtcg cgctaacaac ctcctgccgt tttgcccgtg catatcggtc acgaacaaat
     ctgattacta aacacagtag cctggatttg ttctatcagt aatcgacctt attcctaatt
     aaatagagca aatcccctta ttgggggtaa gacatgaaga tgccagaaaa acatgacctg
     ttggccgcca ttctcgcggc aaaggaacaa ggcatcgggg caatccttgc gtttgcaatg
     gcgtaccttc gcggcagata taatggcggt gcgtttacaa aaacagtaat cgacgcaacg
     atgtgcgcca ttatcgcctg gttcattcgt gaccttctcg acttcgccgg actaagtagc
     aatctcgctt atataacgag cgtgtttatc ggctacatcg gtactgactc gattggttcg
     cttatcaaac gcttcgctgc taaaaaagcc ggagtagaag atggtagaaa tcaataatca
     acgtaaggcg ttcctcgata tgctggcgtg gtcggaggga actgataacg gacgtcagaa
     aaccagaaat catggttatg acgtcattgt aggcggagag ctatttactg attactccga
     tcaccctcgc aaacttgtca cgctaaaccc aaaactcaaa tcaacaggcg ccggacgcta
     ccagcttctt tcccgttggt gggatgccta ccgcaagcag cttggcctga aagacttctc
     tccgaaaagt caggacgctg tggcattgca gcagattaag gagcgtggcg ctttacctat
     gattgatcgt ggtgatatcc gtcaggcaat cgaccgttgc agcaatatct gggcttcact
     gccgggcgct ggttatggtc agttcgagca taaggctgac agcctgattg caaaattcaa
     agaagcgggc ggaacggtca gagagattga tgtatgagca gagtcaccgc gattatctcc
     gctctggtta tctgcatcat cgtctgcctg tcatgggctg ttaatcatta ccgtgataac
     gccattacct acaaagccca gcgcgacaaa aatgccagag aactgaagct ggcgaacgcg
     gcaattactg acatgcagat gcgtcagcgt gatgttgctg cgctcgatgc aaaatacacg
     aaggagttag ctgatgctaa agctgaaaat gatgctctgc gtgatgatgt tgccgctggt
     cgtcgtcggt tgcacatcaa agcagtctgt cagtcagtgc gtgaagccac caccgcctcc
     ggcgtggata atgcagcctc cccccgactg gcagacaccg ctgaacggga ttatttcacc
     ctcagagaga ggctgatcac tatgcaaaaa caactggaag gaacccagaa gtatattaat
     gagcagtgca gatagagttg cccatatcga tgggcaactc atgcaattat tgtgagcaat
     acacacgcgc ttccagcgga gtataaatgc ctaaagtaat aaaaccgagc aatccattta
     cgaatgtttg ctgggtttct gttttaacaa cattttctgc gccgccacaa attttggctg
     catcgacagt tttcttctgc ccaattccag aaacgaagaa atgatgggtg atggtttcct
     ttggtgctac tgctgccggt ttgttttgaa cagtaaacgt ctgttgagca catcctgtaa
     taagcagggc cagcgcagta gcgagtagca tttttttcat ggtgttattc ccgatgcttt
     ttgaagttcg cagaatcgta tgtgtagaaa attaaacaaa ccctaaacaa tgagttgaaa
     tttcatattg ttaatattta ttaatgtatg tcaggtgcga tgaatcgtca ttgtattccc
     ggattaacta tgtccacagc cctgacgggg aacttctctg cgggagtgtc cgggaataat
     taaaacgatg cacacagggt ttagcgcgta cacgtattgc attatgccaa cgccccggtg
     ctgacacgga agaaaccgga cgttatgatt tagcgtggaa agatttgtgt agtgttctga
     atgctctcag taaatagtaa tgaattatca aaggtatagt aatatctttt atgttcatgg
     atatttgtaa cccatcggaa aactcctgct ttagcaagat tttccctgta ttgctgaaat
     gtgatttctc ttgatttcaa cctatcatag gacgtttcta taagatgcgt gtttcttgag
     aatttaacat ttacaacctt tttaagtcct tttattaaca cggtgttatc gttttctaac
     acgatgtgaa tattatctgt ggctagatag taaatataat gtgagacgtt gtgacgtttt
     agttcagaat aaaacaattc acagtctaaa tcttttcgca cttgatcgaa tatttcttta
     aaaatggcaa cctgagccat tggtaaaacc ttccatgtga tacgagggcg cgtagtttgc
     attatcgttt ttatcgtttc aatctggtct gacctccttg tgttttgttg atgatttatg
     tcaaatatta ggaatgtttt cacttaatag tattggttgc gtaacaaagt gcggtcctgc
     tggcattctg gagggaaata caaccgacag atgtatgtaa ggccaacgtg ctcaaatctt
     catacagaaa gatttgaagt aatattttaa ccgctagatg aagagcaagc gcatggagcg
     acaaaatgaa taaagaacaa tctgctgatg atccctccgt ggatctgatt cgtgtaaaaa
     atatgcttaa tagcaccatt tctatgagtt accctgatgt tgtaattgca tgtatagaac
     ataaggtgtc tctggaagca ttcagagcaa ttgaggcagc gttggtgaag cacgataata
     atatgaagga ttattccctg gtggttgact gatcaccata actgctaatc attcaaacta
     tttagtctgt gacagagcca acacgcagtc tgtcactgtc aggaaagtgg taaaactgca
     actcaattac tgcaatgccc tcgtaattaa gtgaatttac aatatcgtcc tgttcggagg
     gaagaacgcg ggatgttcat tcttcatcac ttttaattga tgtatatgct ctcttttctg
     acgttagtct ccgacggcag gcttcaatga cccaggctga gaaattcccg gacccttttt
     gctcaagagc gatgttaatt tgttcaatca tttggttagg aaagcggatg ttgcgggttg
     ttgttctgcg ggttctgttc ttcgttgaca tgaggttgcc ccgtattcag tgtcgctgat
     ttgtattgtc tgaagttgtt tttacgttaa gttgatgcag atcaattaat acgatacctg
     cgtcataatt gattatttga cgtggtttga tggcctccac gcacgttgtg atatgtagat
     gataatcatt atcactttac gggtcctttc cggtgatccg acaggttacg
//