back Return to this vector's summary.
ID   LNSX       preliminary; circular DNA; SYN; 6149 BP.
XX
AC   M28246;
XX
DT   28-JAN-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Mouse Moloney murine sarcoma virus vector LNSX - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-6149
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Miller A.D.;
RT   ;
RL   Unpublished (1989).
XX
RN   [2]
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Miller A.D., Rosman G.J.;
RT   "Improved retroviral vectors for gene transfer and expression";
RL   Biotechniques 7:980-990(1989).
XX
RN   [3]
RP   1-6149
RC   LNSX
RA   Miller A.D.;
RT   ;
RL   Submitted (22-SEP-1989) to GenBank on computer-readable media by:
RL   Miller A.D., Program in Molecular Medicine,
RL   Fred Hutchinson Cancer Research Center, Seattle, WA 98104, USA.
XX
RN   [4]
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Kuebbing D., Freidman S.;
RT   ;
RL   Unpublished (1991).
XX
CC   NCBI gi: 208848
CC   NM (LNSX)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (mouse)
CC   CP ()
CC   FN (gene transfer)(expression)
CC   SE ()
CC   PA (LNL6)
CC   BR (LN)(LNCX)(LXSN)
CC   OF ()
CC   OR (1 bp 5' to EcoRI site)
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. LNL6 remove 681bp,
FT                   \ MMLV LTR/packaging/neo/LTR/polyA/5464bp
FT                   2. SV40 661bp, early promoter
FT                   3. linker StuI-AvrI-HindIII-ClaI 24bp
FT                   \ aggcctcctaggaagcttatcgat
FT                   -> LNSX 6149bp"
FT   misc_recomb     144..145
FT                   /note="mouse DNA end/Moloney murine sarcoma virus
FT                   (Mo-MuSV) DNA start"
FT   LTR             145..733
FT                   /note="RPT Moloney murine sarcoma virus (Mo-MuSV)
FT                   5' long terminal repeat"
FT   misc_signal     803..1612
FT                   /note="extended packaging signal"
FT   misc_recomb     1133..1134
FT                   /note="Moloney murine sarcoma virus (Mo-MuSV) DNA
FT                   end/Moloney murine leukemia virus (Mo-MuLV) DNA start"
FT   mutation        1193..1195
FT                   /note="GAG atg start codon to TAG stop codon"
FT   misc_recomb     1616..1617
FT                   /note="Moloney murine leukemia virus (Mo-MuLV) DNA
FT                   end/transposon Tn5 DNA start"
FT   CDS             1656..2450
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT), neomycin resistance gene (neo)"
FT   misc_recomb     2799..2800
FT                   /note="transposon Tn5 DNA end/SV40 DNA start"
FT   promoter        2800..3146
FT                   /note="PRO SV40 early gene"
FT   misc_recomb     3146..3147
FT                   /note="SV40 DNA end/Moloney murine
FT                   leukemia virus (Mo-MuLV) DNA start"
FT   LTR             3195..3788
FT                   /note="RPT Moloney murine leukemia virus (Mo-MuLV)
FT                   3' long terminal repeat"
FT   misc_recomb     3857..3858
FT                   /note="Moloney murine leukemia virus (Mo-MuLV) DNA
FT                   end/plasmid pBR322 DNA start"
XX
SQ   Sequence 6149 BP; 1398 A; 1708 C; 1596 G; 1447 T; 0 other;
     gaattcatac cagatcaccg aaaactgtcc tccaaatgtg tccccctcac actcccaaat
     tcgcgggctt ctgcctctta gaccactcta ccctattccc cacactcacc ggagccaaag
     ccgcggccct tccgtttctt tgcttttgaa agaccccacc cgtaggtggc aagctagctt
     aagtaacgcc actttgcaag gcatggaaaa atacataact gagaatagaa aagttcagat
     caaggtcagg aacaaagaaa cagctgaata ccaaacagga tatctgtggt aagcggttcc
     tgccccggct cagggccaag aacagatgag acagctgagt gatgggccaa acaggatatc
     tgtggtaagc agttcctgcc ccggctcggg gccaagaaca gatggtcccc agatgcggtc
     cagccctcag cagtttctag tgaatcatca gatgtttcca gggtgcccca aggacctgaa
     aatgaccctg taccttattt gaactaacca atcagttcgc ttctcgcttc tgttcgcgcg
     cttccgctct ccgagctcaa taaaagagcc cacaacccct cactcggcgc gccagtcttc
     cgatagactg cgtcgcccgg gtacccgtat tcccaataaa gcctcttgct gtttgcatcc
     gaatcgtggt ctcgctgttc cttgggaggg tctcctctga gtgattgact acccacgacg
     ggggtctttc atttgggggc tcgtccggga tttggagacc cctgcccagg gaccaccgac
     ccaccaccgg gaggtaagct ggccagcaac ttatctgtgt ctgtccgatt gtctagtgtc
     tatgtttgat gttatgcgcc tgcgtctgta ctagttagct aactagctct gtatctggcg
     gacccgtggt ggaactgacg agttctgaac acccggccgc aaccctggga gacgtcccag
     ggactttggg ggccgttttt gtggcccgac ctgaggaagg gagtcgatgt ggaatccgac
     cccgtcagga tatgtggttc tggtaggaga cgagaaccta aaacagttcc cgcctccgtc
     tgaatttttg ctttcggttt ggaaccgaag ccgcgcgtct tgtctgctgc agcgctgcag
     catcgttctg tgttgtctct gtctgactgt gtttctgtat ttgtctgaaa attagggcca
     gactgttacc actcccttaa gtttgacctt aggtcactgg aaagatgtcg agcggatcgc
     tcacaaccag tcggtagatg tcaagaagag acgttgggtt accttctgct ctgcagaatg
     gccaaccttt aacgtcggat ggccgcgaga cggcaccttt aaccgagacc tcatcaccca
     ggttaagatc aaggtctttt cacctggccc gcatggacac ccagaccagg tcccctacat
     cgtgacctgg gaagccttgg cttttgaccc ccctccctgg gtcaagccct ttgtacaccc
     taagcctccg cctcctcttc ctccatccgc cccgtctctc ccccttgaac ctcctcgttc
     gaccccgcct cgatcctccc tttatccagc cctcactcct tctctaggcg ccggaattcc
     gatctgatca agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg
     caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa
     tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg
     tcaagaccga cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt
     ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa
     gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc
     ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg
     ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg
     aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg
     aactgttcgc caggctcaag gcgcgcatgc ccgacggcga ggatctcgtc gtgacccatg
     gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact
     gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg
     ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc
     ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga gcgggactct
     ggggttcgaa atgaccgacc aagcgacgcc caacctgcca tcacgagatt tcgattccac
     cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat
     cctccagcgc ggggatctca tgctggagtt cttcgcccac cccgggctcg atcccctcgc
     gagttggttc agctgctgcc tgaggctgga cgacctcgcg gagttctacc ggcagtgcaa
     atccgtcggc atccaggaaa ccagcagcgg ctatccgcgc atccatgccc ccgaactgca
     ggagtgggga ggcacgatgg ccgctttggt cgaggcggat ccggctgtgg aatgtgtgtc
     agttagggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc
     tcaattagtc agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc
     aaagcatgca tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc
     ccctaactcc gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt
     atgcagaggc cgaggccgcc tcggcctctg agctattcca gaagtagtga ggaggctttt
     ttggaggcct aggcttttgc aaaaagctta tcgataaaat aaaagatttt atttagtctc
     cagaaaaagg ggggaatgaa agaccccacc tgtaggtttg gcaagctagc ttaagtaacg
     ccattttgca aggcatggaa aaatacataa ctgagaatag agaagttcag atcaaggtca
     ggaacagatg gaacagctga atatgggcca aacaggatat ctgtggtaag cagttcctgc
     cccggctcag ggccaagaac agatggaaca gctgaatatg ggccaaacag gatatctgtg
     gtaagcagtt cctgccccgg ctcagggcca agaacagatg gtccccagat gcggtccagc
     cctcagcagt ttctagagaa ccatcagatg tttccagggt gccccaagga cctgaaatga
     ccctgtgcct tatttgaact aaccaatcag ttcgcttctc gcttctgttc gcgcgcttct
     gctccccgag ctcaataaaa gagcccacaa cccctcactc ggggcgccag tcctccgatt
     gactgagtcg cccgggtacc cgtgtatcca ataaaccctc ttgcagttgc atccgacttg
     tggtctcgct gttccttggg agggtctcct ctgagtgatt gactacccgt cagcgggggt
     ctttcatttg ggggctcgtc cgggatcggg agacccctgc ccagggacca ccgacccacc
     accgggaggt aagctggctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac
     atgcagctcc cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc
     cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt
     agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag
     tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc
     gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg
     tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa
     agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg
     cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga
     ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg
     tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg
     gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc
     gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg
     gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca
     ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt
     ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag
     ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg
     gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc
     ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt
     tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt
     ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca
     gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg
     tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac
     cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg
     ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc
     gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgctg
     caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac
     gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc
     ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac
     tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact
     caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa
     cacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt
     cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca
     ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa
     aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac
     tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg
     gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc
     gaaaagtgcc acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata
     ggcgtatcac gaggcccttt cgtcttcaa
//