back Return to this vector's summary.
ID   LORIST2    preliminary; circular DNA; SYN; 5693 BP.
XX
AC   ATCC37531;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli cosmid vector Lorist2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   LoristE6 from LoristB & oligo, trpA terminator
RC   Lorist2 from LoristE6 & oligo, rrnC terminator
RA   Gibson T.J., Coulson A.R., Sulston J.E., Little P.F.;
RT   "Lorist2, a cosmid with transcriptional terminators insulating
RT   vector genes from interference by promoters within the insert:
RT   effect on DNA yield and cloned insert frequency";
RL   Gene 53:275-281(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Transcription terminators somewhat insulate the vector genes from
CC   insert transcription.
CC   Cosmid vector for genomic library construction.  Insert-end-specific
CC   probes may be generated from T7 and SP6 promoters.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--5.6; HindIII--5.8. (ATCC staff)
CC   Medium is 1236 LB plus kanamycin.
CC   NM (Lorist2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (cosmid)
CC   SP (ATCC)
CC   HO (E.coli 1046)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (LoristE6)
CC   BR ()
CC   OF (Lorist6)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. LoristE6 NheI 5646bp 1185..1185,
FT                   \ LoristB 1153 or may be 4104 [5517bp]
FT                   2. oligo NheI-rrnC-EcoRI-NheI 47bp
FT                   \ ctagaaatcatccttagcgaaagctaaggattttttttatctgaatt,
FT                   \ rrnC terminator
FT                   -> Lorist2 5693bp [5564bp]"
FT   -               1..1184
FT                   /note="LoristE6 1..1184 1184bp
FT                   NheI = G^CTAGC"
FT   -               1185..1231
FT                   /note="ctagaaatcatccttagcgaaagctaaggattttttttatctgaatt
FT                   \ 47bp
FT                   NheI = G^CTAGC"
FT   -               1232..5693
FT                   /note="LoristE6 1185..5646 4462bp"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="MCS unique HindIII-BamHI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   terminator      200..200
FT                   /note="TER E. coli rrnC"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             300..1000
FT                   /note="GEN lambda P gene"
FT   CDS             1000..2000
FT                   /note="GEN lambda O gene"
FT   CDS             2000..2400
FT                   /note="GEN lambda cII gene"
FT   CDS             2500..2700
FT                   /note="GEN lambda cro gene"
FT   promoter        2700..2700
FT                   /note="PRO lambda pR"
FT   promoter        3400..3500
FT                   /note="PRO E. coli neo gene"
FT   CDS             3500..4300
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda cos"
FT   terminator      0..0
FT                   /note="TER E. coli trpA"
XX
SQ   Sequence 5693 BP; 1300 A; 1474 C; 1455 G; 1464 T; 0 other;
     atcgatccgg gcaacgttgt tgccattgct gcaggggggg gggggggggg gggggggggt
     tgacttccat tgttcattcc acggacaaaa acagagaaag gaaacgacag aggccaaaaa
     gcctcgcttt cagcacctgt cgtttccttt cttttcagag ggtattttaa ataaaaacat
     taagttatga cgaagaagaa cggaaacgcc ttaaaccgga aaattttcat aaatagcgaa
     aacccgcgag gtcgccgccc gtaacctgtc ggatcaccgg aaaggacccg taaagtgata
     atgattatca tctacatatc acaacgtgcg tggaggccat caaaccacgt caaataatca
     attatgacgc aggtatcgta ttaattgatc tgcatcaact taacgtaaaa acaacttcag
     acaatacaaa tcagcgacac tgaatacggg gcaacctcat gtcaaccccc cccccccccc
     cccccccccc ctgcaggcgg agaactggta ggtatggaag atctctagag aattagcccg
     cctaatgagc gggctttttt tgaattcgag ctcgcccggg gatcgatcct ctagagtcct
     gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat ggtgcactct
     cagtacaatc tgctctgatg ccgcatagtt aagccagtat atacactccg ctatcgctac
     gtgactgggt catggctgcg ccccgacacc cgccaacacc cgctgacgcg ccctgacggg
     cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt
     gtcagaggtt ttcaccgtca tcaccgaaac gcgcgaggcc cagctggctt atcgaaatta
     atacgactca ctatagggag accggaagct taggatccta tgtattctat agtgtcacct
     aaatcgtatg tgtatgatac ataaggttat gtattaattg tagccgcgtt ctaacgacaa
     tatgtacaag cctaattgtg tagcatctgg cttactgaag cagaccctat catctctctc
     gtaaactgcc gtcagagtcg gtttggttgg acgaaccttc tgagtttctg gtaacgccgt
     cccgcacccg gaaatggtca gcgaaccaat cagcagggtc atcgctagaa atcatcctta
     gcgaaagcta aggatttttt ttatctgaat tctagccaga tccccgggcg agctgcggcc
     tgatttatgc tggttactgt tgcgcctgtt agcgcggcaa cgtccggcgc acagaagcta
     ttatgcgtcc ccaggtaatg aataattgcc tctttgcccg tcatacactt gctcctttca
     gtccgaactt agctttgatt tctgcgatct tcgccagagc ctgtgcacga tttagaggtc
     taccgcccat gacaggaagt tgttttactg gttcagggat cgcctcacca cggttaattc
     tcgcagtcat atggacaagc tcatctgcgg ccttacggcg taattccgca tcagtaagcg
     cattggcccg catgttctga tacaggttgg taaccagcca gtagtgcgcg tttgatttcc
     acggataaga ctccgcatcc ggatacaggc ctcgcttccg gcaatactcg taaaccatat
     caaccagctc gctgacgttt ggcagtccgg cggtaacgga tgcttcttcc cggcaccatg
     caacaaactg cccgggtgat ggcagaaatg gtcgattctg ccgacgggct acgcgcattc
     ctgcgttaac ctgttccatc gtggtgatcc cgttttcccg aaaagccaga acccactggc
     gacggatttc gttcacttcg ttctggtcac ggttagccag gctcgccggg aaagttgcca
     gtaactggct gaacacaccg ttgatgatct gcgctacctg ctgtacctgc ggcttttcgt
     cgtactgttc cggcatgttg ttggcgatcc gacgcatctg ctcacggtca aagttaacca
     tctgtgcggc gatgtttttc atagatccac cccgtaaatc cagtctgtgt ttgtcaggtc
     gagttttggt ttgctggctg tcacgcctgc ctgttgcttg ttacggttga tttcgagttg
     ggtccactta tcgcggagtt tggccgggct cagcacgtta ccggaccaga agttgtcctg
     gcatgcccag cggaacagca cacacatgtc gcggtggtta cgtccgtcac gttcacgcat
     caggcggata tcgttagccc acccagcaaa attcggtttt ctggctgatg gtgcgatagt
     cttcaccatg tcaaacatcc actctgcggc ggtcaggtct tctgctgtcc cccacttgct
     gccgctctga attgcagcat ccggtttcac cacagaaagg tcgttttctg gctggtcaga
     ggattcgcca gaattctctg acgaataatc ttttcttttt tcttttgtaa tagtgtcttt
     tgtgtccccc tgttttgagg gatagcaatc ccccaatttg agggatgttt tatccctcgt
     tttaggggat tttccctcgt tttgagggat gcaccattct gagatgtttt tatttggtcc
     aaacatgccg ccttgctgct tgataatatt cattctgacg agttctaact tggcttcatt
     gcaccgtttg acaggtaact ttgtaatctc gctaagttga gaatcggtga ttctgtccat
     tggtttattc cacccatagg ttttacgcag aatggcaagc agcactttaa actgtcgctt
     ggtcagatct gcgcccgaat aagcctcaag cagcatattt gatagtctgg cgtaaccatc
     atcgagatct gccacattac gctcctgtcc ggcaaagtta cctctgccga agttgagtat
     ttttgctgta tttgtcataa tgactcctgt tgatagatcc agtaatgacc tcagaactcc
     atctggattt gttcagaacg ctcggttgcc gccgggcgtt ttttattggt gagaatcgca
     gcaacttgtc gcgccaatcg agccatgtcg tcgtcaacga ccccccattc aagaacagca
     agcagcattg agaactttgg aatccagtcc ctcttccacc tgctgatctg cgacttatca
     acgcccacag cttccgctgt cttctcagtt ccaagcattg cgattttgtt aagcaacgca
     ctctcgattc gtagagcctc gttgcgtttg tttgcacgaa ccatatgtaa gtatttcctt
     agataacaat tgattgaatg tatgcaaata aatgcataca ccataggtgt ggtttaattt
     gatgcccttt ttcagggctg gaatgtgtaa gagcggggtt atttatgctg ttgttttttt
     gttactcggg aagggcttta cctcttccgc ataaacgctt ccatcagcgt ttatagttaa
     aaaaatcttt cggcctgcat gaatggcctt gttgatcgcg ctttgatata cgccgagatc
     tttagctgtc ttggtttgcc caaagcgcat tgcataatct ttcagggtta tgcgttgttc
     catacaacct ccttagtaca tgcaaccatt atcaccgcca gaggtaaaat agtcaacacg
     cacggtgtta gatatttatc ccttgcggtg atagatttaa cgtatgagca caaaaaagaa
     accattaaca caagagcagc ttgaggacgc acgtcgcctt aaagcaattt atgaaaaaaa
     gaaaaatgaa cttggcttat cccaggaatc tgtcgcagac aagatgggga tggggcagtc
     aggcgttggt gctttattta atggcatcaa tgcattaaat gcttataacg ccgcattgct
     tacaaaaatt ctcaaagtta gcgttgaaga atttagccct tcaatcgcca gagaaatcta
     cgagatgtat gaagcggtta gtatgcagcc gtcacttaga agtgagtatg agtaccctgt
     tttttctcat gttcaggcag ggatgttctc acctgagctt agaaccttta ccaaaggtga
     tgcggagaga tgggtaagca caaccaaaaa agccagtgat tctgcattct ggcttgaggt
     tgaaggtaat tccatgaccg caccaacagg ctccaagcca agctagcttc acgctgccgc
     aagcactcag ggcgcaaggg ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag
     aaacggtgct gaccccggat gaatgtcagc tactgggcta tctggacaag ggaaaacgca
     agcgcaaaga gaaagcaggt agcttgcagt gggcttacat ggcgatagct agactgggcg
     gttttatgga cagcaagcga accggaattg ccagctgggg cgccctctgg taaggttggg
     aagccctgca aagtaaactg gatggctttc ttgccgccaa ggatctgatg gcgcagggga
     tcaagatctg atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg
     cacgcaggtt ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag
     acaatcggct gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt
     tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc aggacgaggc agcgcggcta
     tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg
     ggaagggact ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt
     gctcctgccg agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat
     ccggctacct gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg
     atggaagccg gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca
     gccgaactgt tcgccaggct caaggcgcgc atgcccgacg gcgaggatct cgtcgtgacc
     catggcgatg cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc
     gactgtggcc ggctgggtgt ggcgaccgct atcaggacat agcgttggct acccgtgata
     ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg
     ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc tgagcgggac
     tctggggttc gaaatgaccg accaagcgac gcccaacctg ccatcacgag atttcgattc
     caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat
     gatcctccag cgcggggatc tcatgctgga gttcttcgcc caccccgggc tcgatcccct
     cgcgagttgg ttcagctgct gcctgaggct ggacgacctc gcggagttct accggcagtg
     caaatccgtc ggcatccagg aaaccagcag cggctatccg cgcatccatg cccccgaact
     gcaggagtgg ggaggcacga tggccgcttt ggtcggatca attcgcgcga ccg
//