back Return to this vector's summary.
ID   LORISTE6   preliminary; circular DNA; SYN; 5646 BP.
XX
AC   ATCC37532;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli cosmid vector LoristE6 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   LoristE6 from LoristB & oligo, trpA terminator
RC   Lorist2 from LoristE6 & oligo, rrnC terminator
RA   Gibson T.J., Coulson A.R., Sulston J.E., Little P.F.;
RT   "Lorist2, a cosmid with transcriptional terminators insulating
RT   vector genes from interference by promoters within the insert:
RT   effect on DNA yield and cloned insert frequency";
RL   Gene 53:275-281(1987).
XX
RN   [2]
RC   Lorist3 from Lorist2 & oligo, tet promoter
RC   Lorist4 from Lorist3 & linker
RC   Lorist6 from Lorist4 & oligo, trpA terminator
RA   Gibson T.J., Rosenthal A., Waterson R.H.;
RT   "Lorist6, a cosmid vector with BamHI, NotI, ScaI and HindIII cloning
RT   sites and altered neomycin phosphotransferase gene expression";
RL   Gene 53:283-286(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Accepts blunt-ended DNA.
CC   Cosmid vector for genomic library construction.  Insert-end-specific
CC   probes may be generated from T7 and SP6 promoters.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--5.7; HindIII--5.7. (ATCC staff)
CC   Medium is 1236 LB plus kanamycin.
CC   NM (LoristE6)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (cosmid)
CC   SP (ATCC)
CC   HO (E.coli 1046)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (LoristB)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. LoristB EcoRI 5614bp 531..531, may be 2393
FT                   2. oligo EcoRI-trpA-EcoRI 32bp
FT                   \ aattagcccgcctaatgagcgggctttttttg, trpA terminator
FT                   -> LoristE6 5646bp"
FT   -               1..530
FT                   /note="LoristB 1..530 530bp
FT                   EcoRI = G^AATTC"
FT   -               531..562
FT                   /note="aattagcccgcctaatgagcgggctttttttg 32bp
FT                   EcoRI = G^AATTC"
FT   -               563..5646
FT                   /note="LoristB 531..5614 5084bp"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="MCS unique HindIII-NotI-ScaI-BamHI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   terminator      0..0
FT                   /note="TER E. coli rrnC"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             0..0
FT                   /note="GEN lambda P gene"
FT   CDS             0..0
FT                   /note="GEN lambda O gene"
FT   CDS             0..0
FT                   /note="GEN lambda cII gene"
FT   CDS             0..0
FT                   /note="GEN lambda cro gene"
FT   promoter        0..0
FT                   /note="PRO lambda pR"
FT   promoter        0..0
FT                   /note="PRO E. coli tet gene"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo)"
FT   terminator      0..0
FT                   /note="TER E. coli trpA"
FT   misc_binding    0..0
FT                   /note="SIT lambda cos"
FT   terminator      0..0
FT                   /note="TER E. coli trpA"
XX
SQ   Sequence 5646 BP; 1285 A; 1467 C; 1448 G; 1446 T; 0 other;
     atcgatccgg gcaacgttgt tgccattgct gcaggggggg gggggggggg gggggggggt
     tgacttccat tgttcattcc acggacaaaa acagagaaag gaaacgacag aggccaaaaa
     gcctcgcttt cagcacctgt cgtttccttt cttttcagag ggtattttaa ataaaaacat
     taagttatga cgaagaagaa cggaaacgcc ttaaaccgga aaattttcat aaatagcgaa
     aacccgcgag gtcgccgccc gtaacctgtc ggatcaccgg aaaggacccg taaagtgata
     atgattatca tctacatatc acaacgtgcg tggaggccat caaaccacgt caaataatca
     attatgacgc aggtatcgta ttaattgatc tgcatcaact taacgtaaaa acaacttcag
     acaatacaaa tcagcgacac tgaatacggg gcaacctcat gtcaaccccc cccccccccc
     cccccccccc ctgcaggcgg agaactggta ggtatggaag atctctagag aattagcccg
     cctaatgagc gggctttttt tgaattcgag ctcgcccggg gatcgatcct ctagagtcct
     gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat ggtgcactct
     cagtacaatc tgctctgatg ccgcatagtt aagccagtat atacactccg ctatcgctac
     gtgactgggt catggctgcg ccccgacacc cgccaacacc cgctgacgcg ccctgacggg
     cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt
     gtcagaggtt ttcaccgtca tcaccgaaac gcgcgaggcc cagctggctt atcgaaatta
     atacgactca ctatagggag accggaagct taggatccta tgtattctat agtgtcacct
     aaatcgtatg tgtatgatac ataaggttat gtattaattg tagccgcgtt ctaacgacaa
     tatgtacaag cctaattgtg tagcatctgg cttactgaag cagaccctat catctctctc
     gtaaactgcc gtcagagtcg gtttggttgg acgaaccttc tgagtttctg gtaacgccgt
     cccgcacccg gaaatggtca gcgaaccaat cagcagggtc atcgctagcc agatccccgg
     gcgagctgcg gcctgattta tgctggttac tgttgcgcct gttagcgcgg caacgtccgg
     cgcacagaag ctattatgcg tccccaggta atgaataatt gcctctttgc ccgtcataca
     cttgctcctt tcagtccgaa cttagctttg atttctgcga tcttcgccag agcctgtgca
     cgatttagag gtctaccgcc catgacagga agttgtttta ctggttcagg gatcgcctca
     ccacggttaa ttctcgcagt catatggaca agctcatctg cggccttacg gcgtaattcc
     gcatcagtaa gcgcattggc ccgcatgttc tgatacaggt tggtaaccag ccagtagtgc
     gcgtttgatt tccacggata agactccgca tccggataca ggcctcgctt ccggcaatac
     tcgtaaacca tatcaaccag ctcgctgacg tttggcagtc cggcggtaac ggatgcttct
     tcccggcacc atgcaacaaa ctgcccgggt gatggcagaa atggtcgatt ctgccgacgg
     gctacgcgca ttcctgcgtt aacctgttcc atcgtggtga tcccgttttc ccgaaaagcc
     agaacccact ggcgacggat ttcgttcact tcgttctggt cacggttagc caggctcgcc
     gggaaagttg ccagtaactg gctgaacaca ccgttgatga tctgcgctac ctgctgtacc
     tgcggctttt cgtcgtactg ttccggcatg ttgttggcga tccgacgcat ctgctcacgg
     tcaaagttaa ccatctgtgc ggcgatgttt ttcatagatc caccccgtaa atccagtctg
     tgtttgtcag gtcgagtttt ggtttgctgg ctgtcacgcc tgcctgttgc ttgttacggt
     tgatttcgag ttgggtccac ttatcgcgga gtttggccgg gctcagcacg ttaccggacc
     agaagttgtc ctggcatgcc cagcggaaca gcacacacat gtcgcggtgg ttacgtccgt
     cacgttcacg catcaggcgg atatcgttag cccacccagc aaaattcggt tttctggctg
     atggtgcgat agtcttcacc atgtcaaaca tccactctgc ggcggtcagg tcttctgctg
     tcccccactt gctgccgctc tgaattgcag catccggttt caccacagaa aggtcgtttt
     ctggctggtc agaggattcg ccagaattct ctgacgaata atcttttctt ttttcttttg
     taatagtgtc ttttgtgtcc ccctgttttg agggatagca atcccccaat ttgagggatg
     ttttatccct cgttttaggg gattttccct cgttttgagg gatgcaccat tctgagatgt
     ttttatttgg tccaaacatg ccgccttgct gcttgataat attcattctg acgagttcta
     acttggcttc attgcaccgt ttgacaggta actttgtaat ctcgctaagt tgagaatcgg
     tgattctgtc cattggttta ttccacccat aggttttacg cagaatggca agcagcactt
     taaactgtcg cttggtcaga tctgcgcccg aataagcctc aagcagcata tttgatagtc
     tggcgtaacc atcatcgaga tctgccacat tacgctcctg tccggcaaag ttacctctgc
     cgaagttgag tatttttgct gtatttgtca taatgactcc tgttgataga tccagtaatg
     acctcagaac tccatctgga tttgttcaga acgctcggtt gccgccgggc gttttttatt
     ggtgagaatc gcagcaactt gtcgcgccaa tcgagccatg tcgtcgtcaa cgacccccca
     ttcaagaaca gcaagcagca ttgagaactt tggaatccag tccctcttcc acctgctgat
     ctgcgactta tcaacgccca cagcttccgc tgtcttctca gttccaagca ttgcgatttt
     gttaagcaac gcactctcga ttcgtagagc ctcgttgcgt ttgtttgcac gaaccatatg
     taagtatttc cttagataac aattgattga atgtatgcaa ataaatgcat acaccatagg
     tgtggtttaa tttgatgccc tttttcaggg ctggaatgtg taagagcggg gttatttatg
     ctgttgtttt tttgttactc gggaagggct ttacctcttc cgcataaacg cttccatcag
     cgtttatagt taaaaaaatc tttcggcctg catgaatggc cttgttgatc gcgctttgat
     atacgccgag atctttagct gtcttggttt gcccaaagcg cattgcataa tctttcaggg
     ttatgcgttg ttccatacaa cctccttagt acatgcaacc attatcaccg ccagaggtaa
     aatagtcaac acgcacggtg ttagatattt atcccttgcg gtgatagatt taacgtatga
     gcacaaaaaa gaaaccatta acacaagagc agcttgagga cgcacgtcgc cttaaagcaa
     tttatgaaaa aaagaaaaat gaacttggct tatcccagga atctgtcgca gacaagatgg
     ggatggggca gtcaggcgtt ggtgctttat ttaatggcat caatgcatta aatgcttata
     acgccgcatt gcttacaaaa attctcaaag ttagcgttga agaatttagc ccttcaatcg
     ccagagaaat ctacgagatg tatgaagcgg ttagtatgca gccgtcactt agaagtgagt
     atgagtaccc tgttttttct catgttcagg cagggatgtt ctcacctgag cttagaacct
     ttaccaaagg tgatgcggag agatgggtaa gcacaaccaa aaaagccagt gattctgcat
     tctggcttga ggttgaaggt aattccatga ccgcaccaac aggctccaag ccaagctagc
     ttcacgctgc cgcaagcact cagggcgcaa gggctgctaa aggaagcgga acacgtagaa
     agccagtccg cagaaacggt gctgaccccg gatgaatgtc agctactggg ctatctggac
     aagggaaaac gcaagcgcaa agagaaagca ggtagcttgc agtgggctta catggcgata
     gctagactgg gcggttttat ggacagcaag cgaaccggaa ttgccagctg gggcgccctc
     tggtaaggtt gggaagccct gcaaagtaaa ctggatggct ttcttgccgc caaggatctg
     atggcgcagg ggatcaagat ctgatcaaga gacaggatga ggatcgtttc gcatgattga
     acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga
     ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg
     gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaggacga
     ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt
     tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct
     gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct
     gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg
     agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca
     ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg acggcgagga
     tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt
     ttctggattc atcgactgtg gccggctggg tgtggcgacc gctatcagga catagcgttg
     gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt
     tacggtatcg ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc
     ttctgagcgg gactctgggg ttcgaaatga ccgaccaagc gacgcccaac ctgccatcac
     gagatttcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg
     acgccggctg gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccaccccg
     ggctcgatcc cctcgcgagt tggttcagct gctgcctgag gctggacgac ctcgcggagt
     tctaccggca gtgcaaatcc gtcggcatcc aggaaaccag cagcggctat ccgcgcatcc
     atgcccccga actgcaggag tggggaggca cgatggccgc tttggtcgga tcaattcgcg
     cgaccg
//