back Return to this vector's summary.
ID   LXSN       preliminary; circular DNA; SYN; 5874 BP.
XX
AC   M28248;
XX
DT   28-JAN-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Mouse Moloney murine sarcoma virus vector LXSN - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-5874
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Miller A.D.;
RT   ;
RL   Unpublished (1989).
XX
RN   [2]
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Miller A.D., Rosman G.J.;
RT   "Improved retroviral vectors for gene transfer and expression";
RL   Biotechniques 7:980-990(1989).
XX
RN   [3]
RC   LXSN
RA   Miller A.D.;
RT   ;
RL   Submitted (22-SEP-1989) to GenBank on computer-readable media by:
RL   Miller A.D., Program in Molecular Medicine,
RL   Fred Hutchinson Cancer Research Center, Seattle, WA 98104, USA.
XX
RN   [4]
RC   LN, LNSX, LNCX, LXSN from LNL6
RA   Kuebbing D., Freidman S.;
RT   ;
RL   Unpublished (1991).
XX
CC   retrovirus
CC   NM (LXSN)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (mouse)
CC   CP ()
CC   FN (gene transfer)(expression)
CC   SE ()
CC   PA (LNL6)
CC   BR (LN)(LNCX)(LNSX)
CC   OF ()
CC   OR (junction of neomycin and mouse genomic sequences)
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. MMLV, retroviral LTR/packaging signal
FT                   2. linker EcoRI-HpaI-XhoI-BamHI 24bp
FT                   \ gaattcgttaacctcgagggatcc
FT                   3. SV40 661bp, early promoter
FT                   4. Tn5, neo gene
FT                   5. MMLV, retroviral LTR/polyA
FT                   -> LXSN 5874bp"
FT   misc_recomb     174..175
FT                   /note="mouse DNA end/Moloney murine sarcoma virus
FT                   (Mo-MuSV) DNA start"
FT   LTR             175..763
FT                   /note="RPT Moloney murine sarcoma virus (Mo-MuSV)
FT                   5' long terminal repeat"
FT   misc_signal     833..1642
FT                   /note="extended packaging signal"
FT   misc_recomb     1163..1164
FT                   /note="Moloney murine sarcoma virus (Mo-MuSV) DNA
FT                   end/Moloney murine leukemia virus (Mo-MuLV) DNA start"
FT   mutation        1223..1225
FT                   /note="GAG atg start codon to TAG stop codon"
FT   misc_recomb     1654..1655
FT                   /note="Moloney murine leukemia virus (Mo-MuLV) DNA
FT                   end/SV40 (SV40) DNA start"
FT   promoter        1655..2020
FT                   /note="PRO SV40 early gene"
FT   misc_recomb     2020..2021
FT                   /note="SV40 DNA end/transposon Tn5
FT                   DNA start"
FT   CDS             2066..2860
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT), neomycin resistance gene (neo)"
FT   misc_recomb     2877..2878
FT                   /note="transposon Tn5 DNA end/Moloney murine
FT                   leukemia virus (Mo-MuLV) DNA start"
FT   LTR             2920..3513
FT                   /note="RPT Moloney murine leukemia virus (Mo-MuLV)
FT                   3' long terminal repeat"
FT   misc_recomb     3582..3583
FT                   /note="Moloney murine leukemia virus (Mo-MuLV) DNA
FT                   end/plasmid pBR322 DNA start"
XX
SQ   Sequence 5874 BP; 1351 A; 1611 C; 1515 G; 1397 T; 0 other;
     gaattgctag caattgctag caattgctag caattcatac cagatcaccg aaaactgtcc
     tccaaatgtg tccccctcac actcccaaat tcgcgggctt ctgcctctta gaccactcta
     ccctattccc cacactcacc ggagccaaag ccgcggccct tccgtttctt tgcttttgaa
     agaccccacc cgtaggtggc aagctagctt aagtaacgcc actttgcaag gcatggaaaa
     atacataact gagaatagaa aagttcagat caaggtcagg aacaaagaaa cagctgaata
     ccaaacagga tatctgtggt aagcggttcc tgccccggct cagggccaag aacagatgag
     acagctgagt gatgggccaa acaggatatc tgtggtaagc agttcctgcc ccggctcggg
     gccaagaaca gatggtcccc agatgcggtc cagccctcag cagtttctag tgaatcatca
     gatgtttcca gggtgcccca aggacctgaa aatgaccctg taccttattt gaactaacca
     atcagttcgc ttctcgcttc tgttcgcgcg cttccgctct ccgagctcaa taaaagagcc
     cacaacccct cactcggcgc gccagtcttc cgatagactg cgtcgcccgg gtacccgtat
     tcccaataaa gcctcttgct gtttgcatcc gaatcgtggt ctcgctgttc cttgggaggg
     tctcctctga gtgattgact acccacgacg ggggtctttc atttgggggc tcgtccggga
     tttggagacc cctgcccagg gaccaccgac ccaccaccgg gaggtaagct ggccagcaac
     ttatctgtgt ctgtccgatt gtctagtgtc tatgtttgat gttatgcgcc tgcgtctgta
     ctagttagct aactagctct gtatctggcg gacccgtggt ggaactgacg agttctgaac
     acccggccgc aaccctggga gacgtcccag ggactttggg ggccgttttt gtggcccgac
     ctgaggaagg gagtcgatgt ggaatccgac cccgtcagga tatgtggttc tggtaggaga
     cgagaaccta aaacagttcc cgcctccgtc tgaatttttg ctttcggttt ggaaccgaag
     ccgcgcgtct tgtctgctgc agcgctgcag catcgttctg tgttgtctct gtctgactgt
     gtttctgtat ttgtctgaaa attagggcca gactgttacc actcccttaa gtttgacctt
     aggtcactgg aaagatgtcg agcggatcgc tcacaaccag tcggtagatg tcaagaagag
     acgttgggtt accttctgct ctgcagaatg gccaaccttt aacgtcggat ggccgcgaga
     cggcaccttt aaccgagacc tcatcaccca ggttaagatc aaggtctttt cacctggccc
     gcatggacac ccagaccagg tcccctacat cgtgacctgg gaagccttgg cttttgaccc
     ccctccctgg gtcaagccct ttgtacaccc taagcctccg cctcctcttc ctccatccgc
     cccgtctctc ccccttgaac ctcctcgttc gaccccgcct cgatcctccc tttatccagc
     cctcactcct tctctaggcg ccggaattcg ttaactcgag gatccggctg tggaatgtgt
     gtcagttagg gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc
     atctcaatta gtcagcaacc aggtgtggaa agtccccagg ctccccagca ggcagaagta
     tgcaaagcat gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc
     cgcccctaac tccgcccagt tccgcccatt ctccgcccca tggctgacta atttttttta
     tttatgcaga ggccgaggcc gcctcggcct ctgagctatt ccagaagtag tgaggaggct
     tttttggagg cctaggcttt tgcaaaaagc ttgggctgca ggtcgaggcg gatctgatca
     agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc
     ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc
     tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga
     cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt ggctggccac
     gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct
     gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa
     agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc
     attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct
     tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc
     caggctcaag gcgcgcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg
     cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct
     gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct
     tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca
     gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga gcgggactct ggggttcgat
     aaaataaaag attttattta gtctccagaa aaagggggga atgaaagacc ccacctgtag
     gtttggcaag ctagcttaag taacgccatt ttgcaaggca tggaaaaata cataactgag
     aatagagaag ttcagatcaa ggtcaggaac agatggaaca gctgaatatg ggccaaacag
     gatatctgtg gtaagcagtt cctgccccgg ctcagggcca agaacagatg gaacagctga
     atatgggcca aacaggatat ctgtggtaag cagttcctgc cccggctcag ggccaagaac
     agatggtccc cagatgcggt ccagccctca gcagtttcta gagaaccatc agatgtttcc
     agggtgcccc aaggacctga aatgaccctg tgccttattt gaactaacca atcagttcgc
     ttctcgcttc tgttcgcgcg cttctgctcc ccgagctcaa taaaagagcc cacaacccct
     cactcggggc gccagtcctc cgattgactg agtcgcccgg gtacccgtgt atccaataaa
     ccctcttgca gttgcatccg acttgtggtc tcgctgttcc ttgggagggt ctcctctgag
     tgattgacta cccgtcagcg ggggtctttc atttgggggc tcgtccggga tcgggagacc
     cctgcccagg gaccaccgac ccaccaccgg gaggtaagct ggctgcctcg cgcgtttcgg
     tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta
     agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg
     gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg
     gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc
     gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc
     tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc
     acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg
     aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat
     cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag
     gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga
     tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg
     tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt
     cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac
     gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc
     ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt
     ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc
     ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc
     agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg
     aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag
     atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg
     tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt
     tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca
     tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca
     gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc
     tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt
     ttgcgcaacg ttgttgccat tgctgcaggc atcgtggtgt cacgctcgtc gtttggtatg
     gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc
     aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg
     ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga
     tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga
     ccgagttgct cttgcccggc gtcaacacgg gataataccg cgccacatag cagaacttta
     aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg
     ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact
     ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata
     agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt
     tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa
     ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt
     atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct tcaa
//