back Return to this vector's summary.
ID   M13K82     preliminary; circular DNA; SYN; 7259 BP.
AC   IG5141;
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phage vector M13K8.2 - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   M13K8.1, M13K8.2, M13K8.4 from M13mp8 & oligo
RC   phage from M13K8.4 & M13mp11 FX
RC   M13K11 from phage
RC   M13K11RX from M13K11
RC   M13K11.H4 from M13K11 & pXLHW7, histone H4 gene
RA   Waye M.M., Verhoeyen M.E., Jones P.J., Winter G.;
RT   "EcoK selection vectors for shotgun cloning into M13 and deletion
RT   mutagenesis";
RL   Nucleic Acids Res. 13:8561-8571(1985).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (M13K8.2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp8)
CC   BR (M13K11)(M13K11RX)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. M13mp8 SmaI 7229bp 6239..6239, MCS
FT                   phosphatase
FT                   2. oligo EcoK 30bp
FT                   \ aacccgggagtgctaaacccgggagtgcta
FT                   \ [15bp aacccgggagtgcta]
FT                   T4 polynucleotide kinase
FT                   -> M13K8.2 7259bp [2 copies of EcoK cassette]"
FT   -               1..6238
FT                   /note="M13mp8 1..6238 6238bp
FT                   SmaI = CCC^GGG
FT                   \          aaccc..."
FT   -               6239..6268
FT                   /note="aacccgggagtgctaaacccgggagtgcta 30bp
FT                   \ ...tgcta
FT                   SmaI = CCC^GGG"
FT   -               6269..7259
FT                   /note="M13mp8 6239..7229 991bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
SQ   Sequence 7259 BP; 1771 A; 1542 C; 1536 G; 2410 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt
     ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg
     aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc
     tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc
     gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat
     caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt
     caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta
     gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct
     caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga
     cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta
     tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa
     attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt
     tttttggaga ttttcaacgt gaaaaaatta ttattcgcaa ttcctttagt tgttcctttc
     tattctcact ccgctgaaac tgttgaaagt tgtttagcaa aaccccatac agaaaattca
     tttactaacg tctggaaaga cgacaaaact ttagatcgtt acgctaacta tgagggttgt
     ctgtggaatg ctacaggcgt tgtagtttgt actggtgacg aaactcagtg ttacggtaca
     tgggttccta ttgggcttgc tatccctgaa aatgagggtg gtggctctga gggtggcggt
     tctgagggtg gcggttctga gggtggcggt actaaacctc ctgagtacgg tgatacacct
     attccgggct atacttatat caaccctctc gacggcactt atccgcctgg tactgagcaa
     aaccccgcta atcctaatcc ttctcttgag gagtctcagc ctcttaatac tttcatgttt
     cagaataata ggttccgaaa taggcagggg gcattaactg tttatacggg cactgttact
     caaggcactg accccgttaa aacttattac cagtacactc ctgtatcatc aaaagccatg
     tatgacgctt actggaacgg taaattcaga gactgcgctt tccattctgg ctttaatgaa
     gatccattcg tttgtgaata tcaaggccaa tcgtctgacc tgcctcaacc tcctgtcaat
     gctggcggcg gctctggtgg tggttctggt ggcggctctg agggtggtgg ctctgagggt
     ggcggttctg agggtggcgg ctctgaggga ggcggttccg gtggtggctc tggttccggt
     gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat
     gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt
     gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact
     ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct
     ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct
     tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta
     ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg
     tttgctaaca tactgcgtaa taaggagtct taatcatgcc agttcttttg ggtattccgt
     tattattgcg tttcctcggt ttccttctgg taactttgtt cggctatctg cttacttttc
     ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct cttattattg
     ggcttaactc aattcttgtg ggttatctct ctgatattag cgctcaatta ccctctgact
     ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt tatgttattc
     tctctgtaaa ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt tcttatttgg
     attgggataa ataatatggc tgtttatttt gtaactggca aattaggctc tggaaagacg
     ctcgttagcg ttggtaagat tcaggataaa attgtagctg ggtgcaaaat agcaactaat
     cttgatttaa ggcttcaaaa cctcccgcaa gtcgggaggt tcgctaaaac gcctcgcgtt
     cttagaatac cggataagcc ttctatatct gatttgcttg ctattgggcg cggtaatgat
     tcctacgatg aaaataaaaa cggcttgctt gttctcgatg agtgcggtac ttggtttaat
     acccgttctt ggaatgataa ggaaagacag ccgattattg attggtttct acatgctcgt
     aaattaggat gggatattat ttttcttgtt caggacttat ctattgttga taaacaggcg
     cgttctgcat tagctgaaca tgttgtttat tgtcgtcgtc tggacagaat tactttacct
     tttgtcggta ctttatattc tcttattact ggctcgaaaa tgcctctgcc taaattacat
     gttggcgttg ttaaatatgg cgattctcaa ttaagcccta ctgttgagcg ttggctttat
     actggtaaga atttgtataa cgcatatgat actaaacagg ctttttctag taattatgat
     tccggtgttt attcttattt aacgccttat ttatcacacg gtcggtattt caaaccatta
     aatttaggtc agaagatgaa attaactaaa atatatttga aaaagttttc tcgcgttctt
     tgtcttgcga ttggatttgc atcagcattt acatatagtt atataaccca acctaagccg
     gaggttaaaa aggtagtctc tcagacctat gattttgata aattcactat tgactcttct
     cagcgtctta atctaagcta tcgctatgtt ttcaaggatt ctaagggaaa attaattaat
     agcgacgatt tacagaagca aggttattca ctcacatata ttgatttatg tactgtttcc
     attaaaaaag gtaattcaaa tgaaattgtt aaatgtaatt aattttgttt tcttgatgtt
     tgtttcatca tcttcttttg ctcaggtaat tgaaatgaat aattcgcctc tgcgcgattt
     tgtaacttgg tattcaaagc aatcaggcga atccgttatt gtttctcccg atgtaaaagg
     tactgttact gtatattcat ctgacgttaa acctgaaaat ctacgcaatt tctttatttc
     tgttttacgt gctaataatt ttgatatggt tggttcaatt ccttccataa ttcagaagta
     taatccaaac aatcaggatt atattgatga attgccatca tctgataatc aggaatatga
     tgataattcc gctccttctg gtggtttctt tgttccgcaa aatgataatg ttactcaaac
     ttttaaaatt aataacgttc gggcaaagga tttaatacga gttgtcgaat tgtttgtaaa
     gtctaatact tctaaatcct caaatgtatt atctattgac ggctctaatc tattagttgt
     tagtgcacct aaagatattt tagataacct tcctcaattc ctttctactg ttgatttgcc
     aactgaccag atattgattg agggtttgat atttgaggtt cagcaaggtg atgctttaga
     tttttcattt gctgctggct ctcagcgtgg cactgttgca ggcggtgtta atactgaccg
     cctcacctct gttttatctt ctgctggtgg ttcgttcggt atttttaatg gcgatgtttt
     agggctatca gttcgcgcat taaagactaa tagccattca aaaatattgt ctgtgccacg
     tattcttacg ctttcaggtc agaagggttc tatctctgtt ggccagaatg tcccttttat
     tactggtcgt gtgactggtg aatctgccaa tgtaaataat ccatttcaga cgattgagcg
     tcaaaatgta ggtatttcca tgagcgtttt tcctgttgca atggctggcg gtaatattgt
     tctggatatt accagcaagg ccgatagttt gagttcttct actcaggcaa gtgatgttat
     tactaatcaa agaagtattg ctacaacggt taatttgcgt gatggacaga ctcttttact
     cggtggcctc actgattata aaaacacttc tcaagattct ggcgtaccgt tcctgtctaa
     aatcccttta atcggcctcc tgtttagctc ccgctctgat tccaacgagg aaagcacgtt
     atacgtgctc gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg
     gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggaa ccaccatcaa
     acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg
     ccaggcggtg aagggcaatc agctgttgcc cgtctcgctg gtgaaaagaa aaaccaccct
     ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gaattcccaa
     cccgggagtg ctaaacccgg gagtgctagg ggatccgtcg acctgcagcc aagcttggca
     ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc
     cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc
     ccttcccaac agttgcgcag cctgaatggc gaatggcgct ttgcctggtt tccggcacca
     gaagcggtgc cggaaagctg gctggagtgc gatcttcctg aggccgatac ggtcgtcgtc
     ccctcaaact ggcagatgca cggttacgat gcgcccatct acaccaacgt aacctatccc
     attacggtca atccgccgtt tgttcccacg gagaatccga cgggttgtta ctcgctcaca
     tttaatgttg atgaaagctg gctacaggaa ggccagacgc gaattatttt tgatggcgtt
     cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat
     taacgtttac aatttaaata tttgcttata caatcttcct gtttttgggg cttttctgat
     tatcaaccgg ggtacatatg attgacatgc tagttttacg attaccgttc atcgattctc
     ttgtttgctc cagactctca ggcaatgacc tgatagcctt tgtagatctc tcaaaaatag
     ctaccctctc cggcattaat ttatcagcta gaacggttga atatcatatt gatggtgatt
     tgactgtctc cggcctttct cacccttttg aatctttacc tacacattac tcaggcattg
     catttaaaat atatgagggt tctaaaaatt tttatccttg cgttgaaata aaggcttctc
     ccgcaaaagt attacagggt cataatgttt ttggtacaac cgatttagct ttatgctctg
     aggctttatt gcttaatttt gctaattctt tgccttgcct gtatgattta ttggatgtt