back Return to this vector's summary.
ID   M13M663    preliminary; circular DNA; SYN; 7264 BP.
XX
AC   IG5019;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector M13m663 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   M13m655, M13m663, M13m666 from M13mp8 & pBR322
RA   Fowlkes D.M., Adams M.D., Fowler V.A., Kay B.K.;
RT   "Multipurpose vectors for peptide expression on the M13 viral
RT   surface";
RL   Biotechniques 13:422-428(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (M13m663)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp8)
CC   BR (M13m655)(M13m666)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp8 remove 6bp 1579..1585, 7223bp
FT                   mutagenic primer ctcgag
FT                   -> mutant M13mp8 7229bp [XhoI in AA1/AA2 in pIII gene]
FT                   1. mutant M13mp8 XhoI 7229bp 1580..1580
FT                   2. oligo XhoI-XhoI 35bp
FT                   \ tcgagcagaaactgatctctgaagaagacctgaac,
FT                   \ human c-myc gene epitope
FT                   -> M13m663 7264bp [lacZ gene; XhoI & XbaI]"
FT   -               1..1578
FT                   /note="M13mp8 1..1578 1578bp"
FT   -               1579..1579
FT                   /note="c 1bp
FT                   XhoI = C^TCGAG
FT                   \        tcgag..."
FT   -               1580..1614
FT                   /note="tcgagcagaaactgatctctgaagaagacctgaac 35bp
FT                   \ ...tgaac
FT                   XhoI =   C^TCGAG"
FT   -               1615..1619
FT                   /note="tcgag 5bp
FT                   XhoI =   C^TCGAG"
FT   -               1620..7264
FT                   /note="M13mp8 1585..7229 5645bp"
FT   CDS             0..0
FT                   /note="GEN bacteriophage M13 pIII gene"
FT   misc_binding    0..0
FT                   /note="SIT XhoI"
FT   misc_feature    0..0
FT                   /note="SIT bacteriophage M13 pIII gene signal
FT                   peptide cleavage site"
FT   misc_feature    0..0
FT                   /note="SIT human c-myc gene epitope, recognized by
FT                   9E10 monoclonal antibody"
FT   misc_binding    0..0
FT                   /note="SIT XbaI"
FT   CDS             complement(0..0)
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 7264 BP; 1774 A; 1544 C; 1534 G; 2412 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt
     ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg
     aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc
     tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc
     gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat
     caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt
     caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta
     gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct
     caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga
     cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta
     tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa
     attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt
     tttttggaga ttttcaacct cgagcagaaa ctgatctctg aagaagacct gaactcgaga
     aattattatt cgcaattcct ttagttgttc ctttctattc tcactccgct gaaactgttg
     aaagttgttt agcaaaaccc catacagaaa attcatttac taacgtctgg aaagacgaca
     aaactttaga tcgttacgct aactatgagg gttgtctgtg gaatgctaca ggcgttgtag
     tttgtactgg tgacgaaact cagtgttacg gtacatgggt tcctattggg cttgctatcc
     ctgaaaatga gggtggtggc tctgagggtg gcggttctga gggtggcggt tctgagggtg
     gcggtactaa acctcctgag tacggtgata cacctattcc gggctatact tatatcaacc
     ctctcgacgg cacttatccg cctggtactg agcaaaaccc cgctaatcct aatccttctc
     ttgaggagtc tcagcctctt aatactttca tgtttcagaa taataggttc cgaaataggc
     agggggcatt aactgtttat acgggcactg ttactcaagg cactgacccc gttaaaactt
     attaccagta cactcctgta tcatcaaaag ccatgtatga cgcttactgg aacggtaaat
     tcagagactg cgctttccat tctggcttta atgaagatcc attcgtttgt gaatatcaag
     gccaatcgtc tgacctgcct caacctcctg tcaatgctgg cggcggctct ggtggtggtt
     ctggtggcgg ctctgagggt ggtggctctg agggtggcgg ttctgagggt ggcggctctg
     agggaggcgg ttccggtggt ggctctggtt ccggtgattt tgattatgaa aagatggcaa
     acgctaataa gggggctatg accgaaaatg ccgatgaaaa cgcgctacag tctgacgcta
     aaggcaaact tgattctgtc gctactgatt acggtgctgc tatcgatggt ttcattggtg
     acgtttccgg ccttgctaat ggtaatggtg ctactggtga ttttgctggc tctaattccc
     aaatggctca agtcggtgac ggtgataatt cacctttaat gaataatttc cgtcaatatt
     taccttccct ccctcaatcg gttgaatgtc gcccttttgt ctttagcgct ggtaaaccat
     atgaattttc tattgattgt gacaaaataa acttattccg tggtgtcttt gcgtttcttt
     tatatgttgc cacctttatg tatgtatttt ctacgtttgc taacatactg cgtaataagg
     agtcttaatc atgccagttc ttttgggtat tccgttatta ttgcgtttcc tcggtttcct
     tctggtaact ttgttcggct atctgcttac ttttcttaaa aagggcttcg gtaagatagc
     tattgctatt tcattgtttc ttgctcttat tattgggctt aactcaattc ttgtgggtta
     tctctctgat attagcgctc aattaccctc tgactttgtt cagggtgttc agttaattct
     cccgtctaat gcgcttccct gtttttatgt tattctctct gtaaaggctg ctattttcat
     ttttgacgtt aaacaaaaaa tcgtttctta tttggattgg gataaataat atggctgttt
     attttgtaac tggcaaatta ggctctggaa agacgctcgt tagcgttggt aagattcagg
     ataaaattgt agctgggtgc aaaatagcaa ctaatcttga tttaaggctt caaaacctcc
     cgcaagtcgg gaggttcgct aaaacgcctc gcgttcttag aataccggat aagccttcta
     tatctgattt gcttgctatt gggcgcggta atgattccta cgatgaaaat aaaaacggct
     tgcttgttct cgatgagtgc ggtacttggt ttaatacccg ttcttggaat gataaggaaa
     gacagccgat tattgattgg tttctacatg ctcgtaaatt aggatgggat attatttttc
     ttgttcagga cttatctatt gttgataaac aggcgcgttc tgcattagct gaacatgttg
     tttattgtcg tcgtctggac agaattactt taccttttgt cggtacttta tattctctta
     ttactggctc gaaaatgcct ctgcctaaat tacatgttgg cgttgttaaa tatggcgatt
     ctcaattaag ccctactgtt gagcgttggc tttatactgg taagaatttg tataacgcat
     atgatactaa acaggctttt tctagtaatt atgattccgg tgtttattct tatttaacgc
     cttatttatc acacggtcgg tatttcaaac cattaaattt aggtcagaag atgaaattaa
     ctaaaatata tttgaaaaag ttttctcgcg ttctttgtct tgcgattgga tttgcatcag
     catttacata tagttatata acccaaccta agccggaggt taaaaaggta gtctctcaga
     cctatgattt tgataaattc actattgact cttctcagcg tcttaatcta agctatcgct
     atgttttcaa ggattctaag ggaaaattaa ttaatagcga cgatttacag aagcaaggtt
     attcactcac atatattgat ttatgtactg tttccattaa aaaaggtaat tcaaatgaaa
     ttgttaaatg taattaattt tgttttcttg atgtttgttt catcatcttc ttttgctcag
     gtaattgaaa tgaataattc gcctctgcgc gattttgtaa cttggtattc aaagcaatca
     ggcgaatccg ttattgtttc tcccgatgta aaaggtactg ttactgtata ttcatctgac
     gttaaacctg aaaatctacg caatttcttt atttctgttt tacgtgctaa taattttgat
     atggttggtt caattccttc cataattcag aagtataatc caaacaatca ggattatatt
     gatgaattgc catcatctga taatcaggaa tatgatgata attccgctcc ttctggtggt
     ttctttgttc cgcaaaatga taatgttact caaactttta aaattaataa cgttcgggca
     aaggatttaa tacgagttgt cgaattgttt gtaaagtcta atacttctaa atcctcaaat
     gtattatcta ttgacggctc taatctatta gttgttagtg cacctaaaga tattttagat
     aaccttcctc aattcctttc tactgttgat ttgccaactg accagatatt gattgagggt
     ttgatatttg aggttcagca aggtgatgct ttagattttt catttgctgc tggctctcag
     cgtggcactg ttgcaggcgg tgttaatact gaccgcctca cctctgtttt atcttctgct
     ggtggttcgt tcggtatttt taatggcgat gttttagggc tatcagttcg cgcattaaag
     actaatagcc attcaaaaat attgtctgtg ccacgtattc ttacgctttc aggtcagaag
     ggttctatct ctgttggcca gaatgtccct tttattactg gtcgtgtgac tggtgaatct
     gccaatgtaa ataatccatt tcagacgatt gagcgtcaaa atgtaggtat ttccatgagc
     gtttttcctg ttgcaatggc tggcggtaat attgttctgg atattaccag caaggccgat
     agtttgagtt cttctactca ggcaagtgat gttattacta atcaaagaag tattgctaca
     acggttaatt tgcgtgatgg acagactctt ttactcggtg gcctcactga ttataaaaac
     acttctcaag attctggcgt accgttcctg tctaaaatcc ctttaatcgg cctcctgttt
     agctcccgct ctgattccaa cgaggaaagc acgttatacg tgctcgtcaa agcaaccata
     gtacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac
     cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc
     cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt
     tagtgcttta cggcacctcg accccaaaaa acttgatttg ggtgatggtt cacgtagtgg
     gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag
     tggactcttg ttccaaactg gaacaacact caaccctatc tcgggctatt cttttgattt
     ataagggatt ttgccgattt cggaaccacc atcaaacagg attttcgcct gctggggcaa
     accagcgtgg accgcttgct gcaactctct cagggccagg cggtgaaggg caatcagctg
     ttgcccgtct cgctggtgaa aagaaaaacc accctggcgc ccaatacgca aaccgcctct
     ccccgcgcgt tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc
     gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact cattaggcac cccaggcttt
     acactttatg cttccggctc gtatgttgtg tggaattgtg agcggataac aatttcacac
     aggaaacagc tatgaccatg attacgaatt cccggggatc cgtcgacctg cagccaagct
     tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta
     atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg
     atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgctttgcc tggtttccgg
     caccagaagc ggtgccggaa agctggctgg agtgcgatct tcctgaggcc gatacggtcg
     tcgtcccctc aaactggcag atgcacggtt acgatgcgcc catctacacc aacgtaacct
     atcccattac ggtcaatccg ccgtttgttc ccacggagaa tccgacgggt tgttactcgc
     tcacatttaa tgttgatgaa agctggctac aggaaggcca gacgcgaatt atttttgatg
     gcgttcctat tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa
     aatattaacg tttacaattt aaatatttgc ttatacaatc ttcctgtttt tggggctttt
     ctgattatca accggggtac atatgattga catgctagtt ttacgattac cgttcatcga
     ttctcttgtt tgctccagac tctcaggcaa tgacctgata gcctttgtag atctctcaaa
     aatagctacc ctctccggca ttaatttatc agctagaacg gttgaatatc atattgatgg
     tgatttgact gtctccggcc tttctcaccc ttttgaatct ttacctacac attactcagg
     cattgcattt aaaatatatg agggttctaa aaatttttat ccttgcgttg aaataaaggc
     ttctcccgca aaagtattac agggtcataa tgtttttggt acaaccgatt tagctttatg
     ctctgaggct ttattgctta attttgctaa ttctttgcct tgcctgtatg atttattgga
     tgtt
//