back Return to this vector's summary.
ID   M13PLEX05  preliminary; circular DNA; SYN; 7268 BP.
AC   M64053;
DT   10-OCT-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phage vector M13plex05 - complete beta-galactosidase.
KW   cloning vector; beta-galactosidase.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-99
RC   M13plex series from pSATH1 & lambda ZAP II
RC   NOTE: SSAT = spermine N-1-acetyltransferase
RA   Xiao L., Celano P., Mank A.R., Pegg A.E., Casero R.A.;
RT   "Characterization of a full length cDNA which codes for the human
RT   spermidine/spermine N-1-acetyltransferase";
RL   Biochem. Biophys. Res. Commun. 179:407-415(1991).
RN   [2]
RC   M13plex series from M13mp9 & plex series
RA   Heller C., Radley E., Khurshid F., Beck S.;
RT   "M13plex vectors for multiplex DNA sequencing";
RL   Gene 103:131-132(1991).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 208019
CC   NM (M13plex05)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phage)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp9)(pSATH1)
CC   BR (M13plex01)(M13plex00)(M13plex06)(M13plex07)(M13plex10)
CC   BR (M13plex13)(M13plex17)(M13plex18)(M13plex19)(M13plex20)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove EcoRI-PvuII 2068bp
FT                   \ 4360..4361..2067, 2293bp
FT                   2. oligo EcoRI-PstI-EcoRI-E. coli rpoC term-PvuII 59bp
FT                   \ aattaaaaaaccgctgcgtctgcagcggaattcaaaaacccgcttcggcgg
FT                   \ gttttttt
FT                   -> plasmid 2352bp
FT                   1. plasmid remove EcoRI-PstI 8bp 1..8, in oligo,2344bp
FT                   2. oligo EcoRI-PstI 83bp
FT                   \ cacctgcagcggccgchhhhhhhhhhhhhhhhhhhhhhhhhh
FT                   \ ggtacccgggagctcdddddddddddddddddddddddd
FT                   \ gcggccgcgaattcgtg
FT                   -> plex05 2427bp
FT                   1. M13mp9 remove SmaI-EcoRI 3bp 6632..6635, MCS/7596bp
FT                   2. plex05 SmaI-EcoRI 42bp, tag sequence
FT                   \ gggagctcggtgaatttgagatttgagttatgtgcggccgcg
FT                   -> M13plex05 7268bp"
FT   -               1..6631
FT                   /note="M13mp9 1..6631 6631bp
FT                   SmaI = CCC^GGG"
FT   -               6632..6673
FT                   /note="plex05
FT                   \ gggagctcggtgaatttgagatttgagttatgtgcggccgcg 42bp
FT                   EcoRI = G^AATTC"
FT   -               6674..7268
FT                   /note="M13mp9 6635..7229 595bp"
FT   CDS             1..92
FT                   /note="mutated beta-galactosidase; pseudo; putative"
FT   misc_feature    53..78
FT                   /note="tag sequence; putative"
SQ   Sequence 7268 BP; 1769 A; 1539 C; 1544 G; 2416 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt
     ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg
     aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc
     tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc
     gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat
     caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt
     caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta
     gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct
     caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga
     cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta
     tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa
     attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt
     tttttggaga ttttcaacgt gaaaaaatta ttattcgcaa ttcctttagt tgttcctttc
     tattctcact ccgctgaaac tgttgaaagt tgtttagcaa aaccccatac agaaaattca
     tttactaacg tctggaaaga cgacaaaact ttagatcgtt acgctaacta tgagggttgt
     ctgtggaatg ctacaggcgt tgtagtttgt actggtgacg aaactcagtg ttacggtaca
     tgggttccta ttgggcttgc tatccctgaa aatgagggtg gtggctctga gggtggcggt
     tctgagggtg gcggttctga gggtggcggt actaaacctc ctgagtacgg tgatacacct
     attccgggct atacttatat caaccctctc gacggcactt atccgcctgg tactgagcaa
     aaccccgcta atcctaatcc ttctcttgag gagtctcagc ctcttaatac tttcatgttt
     cagaataata ggttccgaaa taggcagggg gcattaactg tttatacggg cactgttact
     caaggcactg accccgttaa aacttattac cagtacactc ctgtatcatc aaaagccatg
     tatgacgctt actggaacgg taaattcaga gactgcgctt tccattctgg ctttaatgaa
     gatccattcg tttgtgaata tcaaggccaa tcgtctgacc tgcctcaacc tcctgtcaat
     gctggcggcg gctctggtgg tggttctggt ggcggctctg agggtggtgg ctctgagggt
     ggcggttctg agggtggcgg ctctgaggga ggcggttccg gtggtggctc tggttccggt
     gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat
     gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt
     gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact
     ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct
     ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct
     tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta
     ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg
     tttgctaaca tactgcgtaa taaggagtct taatcatgcc agttcttttg ggtattccgt
     tattattgcg tttcctcggt ttccttctgg taactttgtt cggctatctg cttacttttc
     ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct cttattattg
     ggcttaactc aattcttgtg ggttatctct ctgatattag cgctcaatta ccctctgact
     ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt tatgttattc
     tctctgtaaa ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt tcttatttgg
     attgggataa ataatatggc tgtttatttt gtaactggca aattaggctc tggaaagacg
     ctcgttagcg ttggtaagat tcaggataaa attgtagctg ggtgcaaaat agcaactaat
     cttgatttaa ggcttcaaaa cctcccgcaa gtcgggaggt tcgctaaaac gcctcgcgtt
     cttagaatac cggataagcc ttctatatct gatttgcttg ctattgggcg cggtaatgat
     tcctacgatg aaaataaaaa cggcttgctt gttctcgatg agtgcggtac ttggtttaat
     acccgttctt ggaatgataa ggaaagacag ccgattattg attggtttct acatgctcgt
     aaattaggat gggatattat ttttcttgtt caggacttat ctattgttga taaacaggcg
     cgttctgcat tagctgaaca tgttgtttat tgtcgtcgtc tggacagaat tactttacct
     tttgtcggta ctttatattc tcttattact ggctcgaaaa tgcctctgcc taaattacat
     gttggcgttg ttaaatatgg cgattctcaa ttaagcccta ctgttgagcg ttggctttat
     actggtaaga atttgtataa cgcatatgat actaaacagg ctttttctag taattatgat
     tccggtgttt attcttattt aacgccttat ttatcacacg gtcggtattt caaaccatta
     aatttaggtc agaagatgaa attaactaaa atatatttga aaaagttttc tcgcgttctt
     tgtcttgcga ttggatttgc atcagcattt acatatagtt atataaccca acctaagccg
     gaggttaaaa aggtagtctc tcagacctat gattttgata aattcactat tgactcttct
     cagcgtctta atctaagcta tcgctatgtt ttcaaggatt ctaagggaaa attaattaat
     agcgacgatt tacagaagca aggttattca ctcacatata ttgatttatg tactgtttcc
     attaaaaaag gtaattcaaa tgaaattgtt aaatgtaatt aattttgttt tcttgatgtt
     tgtttcatca tcttcttttg ctcaggtaat tgaaatgaat aattcgcctc tgcgcgattt
     tgtaacttgg tattcaaagc aatcaggcga atccgttatt gtttctcccg atgtaaaagg
     tactgttact gtatattcat ctgacgttaa acctgaaaat ctacgcaatt tctttatttc
     tgttttacgt gctaataatt ttgatatggt tggttcaatt ccttccataa ttcagaagta
     taatccaaac aatcaggatt atattgatga attgccatca tctgataatc aggaatatga
     tgataattcc gctccttctg gtggtttctt tgttccgcaa aatgataatg ttactcaaac
     ttttaaaatt aataacgttc gggcaaagga tttaatacga gttgtcgaat tgtttgtaaa
     gtctaatact tctaaatcct caaatgtatt atctattgac ggctctaatc tattagttgt
     tagtgcacct aaagatattt tagataacct tcctcaattc ctttctactg ttgatttgcc
     aactgaccag atattgattg agggtttgat atttgaggtt cagcaaggtg atgctttaga
     tttttcattt gctgctggct ctcagcgtgg cactgttgca ggcggtgtta atactgaccg
     cctcacctct gttttatctt ctgctggtgg ttcgttcggt atttttaatg gcgatgtttt
     agggctatca gttcgcgcat taaagactaa tagccattca aaaatattgt ctgtgccacg
     tattcttacg ctttcaggtc agaagggttc tatctctgtt ggccagaatg tcccttttat
     tactggtcgt gtgactggtg aatctgccaa tgtaaataat ccatttcaga cgattgagcg
     tcaaaatgta ggtatttcca tgagcgtttt tcctgttgca atggctggcg gtaatattgt
     tctggatatt accagcaagg ccgatagttt gagttcttct actcaggcaa gtgatgttat
     tactaatcaa agaagtattg ctacaacggt taatttgcgt gatggacaga ctcttttact
     cggtggcctc actgattata aaaacacttc tcaagattct ggcgtaccgt tcctgtctaa
     aatcccttta atcggcctcc tgtttagctc ccgctctgat tccaacgagg aaagcacgtt
     atacgtgctc gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg
     gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggaa ccaccatcaa
     acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg
     ccaggcggtg aagggcaatc agctgttgcc cgtctcgctg gtgaaaagaa aaaccaccct
     ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagcttg
     gctgcaggtc gacggatccc cgggaattca ctggccgtcg ttttacaacg tcgtgactgg
     gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg
     cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc
     gaatggcgct ttgcctggtt tccggcacca gaagcggtgc cggaaagctg gctggagtgc
     gatcttcctg aggccgatac ggtcgtcgtc ccctcaaact ggcagatgca cggttacgat
     gcgcccatct acaccaacgt aacctatccc attacggtca atccgccgtt tgttcccacg
     gagaatccga cgggttgtta ctcgctcaca tgggagctcg gtgaatttga gatttgagtt
     atgtgcggcc gcgatgttga tgaaagctgg ctacaggaag gccagacgcg aattattttt
     gatggcgttc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta
     acaaaatatt aacgtttaca atttaaatat ttgcttatac aatcttcctg tttttggggc
     ttttctgatt atcaaccggg gtacatatga ttgacatgct agttttacga ttaccgttca
     tcgattctct tgtttgctcc agactctcag gcaatgacct gatagccttt gtagatctct
     caaaaatagc taccctctcc ggcattaatt tatcagctag aacggttgaa tatcatattg
     atggtgattt gactgtctcc ggcctttctc acccttttga atctttacct acacattact
     caggcattgc atttaaaata tatgagggtt ctaaaaattt ttatccttgc gttgaaataa
     aggcttctcc cgcaaaagta ttacagggtc ataatgtttt tggtacaacc gatttagctt
     tatgctctga ggctttattg cttaattttg ctaattcttt gccttgcctg tatgatttat