back Return to this vector's summary.
ID   M13TG130   preliminary; circular DNA; SYN; 7265 BP.
XX
AC   L08828; VB0054; IG0010; K01158;
XX
DT   20-NOV-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector M13tg130 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-7265
RC   M13tg130
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [2]
RC   ptg130 from pBR322 & oligo
RC   M13tg130 from M13tg109 & ptg130
RC   M13tg115 from linker & M13tg110
RC   M13tg119 from M13tg115 & linker
RC   M13tg120 from M13tg119 & M13mp701 & M13mp7
RC   M13tg131 from M13tg130 & M13tg120
RA   Kieny M.P., Lathe R.F., Lecocq J.P.;
RT   "New versatile cloning and sequencing vectors based on
RT   bacteriophage M13";
RL   Gene 26:91-99(1983).
XX
RN   [3]
RC   M13mp701 from M13mp7
RA   Bentley D.R.;
RT   ;
RL   Unpublished (1983).
XX
RN   [4]
RC   pRG from pBR322 & rabies virus glycoprotein
RA   Anilionis A., Wunner W.H., Curtis P.J.;
RT   "Structure of the glycoprotein gene in rabies virus";
RL   Nature 294:275-278(1981).
XX
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   Assembled from M13mp7 and M13tg130-Polylinker by F. Pfeiffer.
CC   M13 is not lytic; the phage extrude through the cell wall.
CC   The replicative RF I form in the cell is double-stranded and
CC   circular, and acts like a plasmid.
CC   The phage form outside the cell is linear and single-stranded.
CC   A series of deletions and replacements into the polylinker
CC   of M13mp7 creates the final polylinker.
CC   Amersham vector is 7195 bp.
CC   NM (M13tg130)
CC   CM (yes)
CC   NA (filamentous ss-DNA)(ds-DNA)
CC   TP (linear)(circular)
CC   ST ()
CC   TY (phage)
CC   SP (Amersham)
CC   HO (E.coli JM101)(E.coli JM103)(E.coli JM105)
CC   HO (E.coli JM107)(E.coli JM109)(E.coli DH5alphaF')
CC   CP ()
CC   FN (cloning)(sequencing dideoxy)(in vitro mutagenesis)
CC   FN (labeled strand-specific DNA)
CC   SE (color blue/white)
CC   PA (M13mp7)
CC   BR (M13tg131)
CC   OF (pUC830)(pOM2)(pOM4)(pOM8)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 SalI-ClaI 3734bp 652..4361..25
FT                   Klenow:Klenow
FT                   2. oligo EcoRI-HindIII 57bp
FT                   \ atcgaattcccgggagagctcgatatcgcatgcggtacctctagaagaag
FT                   \ cttcgac
FT                   -> ptg130 3791bp
FT                   1. ptg130 EcoRI-HindIII 57bp, MCS
FT                   \ pBR322 4360..4361..30
FT                   2. M13tg109 remove small EcoRI-HindIII, 7200bp
FT                   -> M13tg130 7265bp"
FT   CDS             join(6864..7195,1..831)
FT                   /note="GEN bacteriophage M13 gene II (rf replication
FT                   and nicking)"
FT   CDS             496..831
FT                   /note="GEN bacteriophage M13 gene X"
FT   CDS             843..1106
FT                   /note="GEN bacteriophage M13 gene V (single stranded
FT                   binding protein)"
FT   CDS             1108..1209
FT                   /note="GEN bacteriophage M13 gene VII (morphogenesis)"
FT   CDS             1206..1304
FT                   /note="GEN bacteriophage M13 gene IX (minor coat
FT                   protein)"
FT   CDS             1301..1522
FT                   /note="GEN bacteriophage M13 gene VIII (major coat
FT                   protein)"
FT   CDS             1579..2853
FT                   /note="GEN bacteriophage M13 gene III (adsorption
FT                   protein)"
FT   CDS             2856..3194
FT                   /note="GEN bacteriophage M13 gene VI (morphogenesis)"
FT   CDS             3196..4242
FT                   /note="GEN bacteriophage M13 gene I (morphogenesis)"
FT   CDS             4220..5500
FT                   /note="GEN bacteriophage M13 gene IV (morphogenesis)"
FT   rep_origin      complement(5488..5868)
FT                   /note="ORI bacteriophage M13 intergenic region
FT                   (M13IG)"
FT   promoter        6095..6216
FT                   /note="PRO E. coli lac operator region"
FT   CDS             6217..6699
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   primer_bind     0..0
FT                   /note="PRI bacteriophage M13 -40"
FT   primer_bind     0..0
FT                   /note="PRI bacteriophage M13 universal"
FT   primer_bind     0..0
FT                   /note="PRI bacteriophage M13 reverse"
FT   misc_feature    1..6230
FT                   /note="from M13mp7"
FT   misc_feature    6231..6299
FT                   /note="MCS EcoRI-SmaI-SacI-EcoRV-SphI-KpnI-XbaI-
FT                   HindIII-BamHI-SalI-PstI"
FT   misc_feature    6300..7265
FT                   /note="from M13mp7"
XX
SQ   Sequence 7265 BP; 1774 A; 1541 C; 1535 G; 2415 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt
     ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg
     aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc
     tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc
     gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat
     caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt
     caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta
     gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct
     caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga
     cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta
     tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa
     attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt
     tttttggaga ttttcaacgt gaaaaaatta ttattcgcaa ttcctttagt tgttcctttc
     tattctcact ccgctgaaac tgttgaaagt tgtttagcaa aaccccatac agaaaattca
     tttactaacg tctggaaaga cgacaaaact ttagatcgtt acgctaacta tgagggttgt
     ctgtggaatg ctacaggcgt tgtagtttgt actggtgacg aaactcagtg ttacggtaca
     tgggttccta ttgggcttgc tatccctgaa aatgagggtg gtggctctga gggtggcggt
     tctgagggtg gcggttctga gggtggcggt actaaacctc ctgagtacgg tgatacacct
     attccgggct atacttatat caaccctctc gacggcactt atccgcctgg tactgagcaa
     aaccccgcta atcctaatcc ttctcttgag gagtctcagc ctcttaatac tttcatgttt
     cagaataata ggttccgaaa taggcagggg gcattaactg tttatacggg cactgttact
     caaggcactg accccgttaa aacttattac cagtacactc ctgtatcatc aaaagccatg
     tatgacgctt actggaacgg taaattcaga gactgcgctt tccattctgg ctttaatgaa
     gatccattcg tttgtgaata tcaaggccaa tcgtctgacc tgcctcaacc tcctgtcaat
     gctggcggcg gctctggtgg tggttctggt ggcggctctg agggtggtgg ctctgagggt
     ggcggttctg agggtggcgg ctctgaggga ggcggttccg gtggtggctc tggttccggt
     gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat
     gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt
     gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact
     ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct
     ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct
     tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta
     ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg
     tttgctaaca tactgcgtaa taaggagtct taatcatgcc agttcttttg ggtattccgt
     tattattgcg tttcctcggt ttccttctgg taactttgtt cggctatctg cttacttttc
     ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct cttattattg
     ggcttaactc aattcttgtg ggttatctct ctgatattag cgctcaatta ccctctgact
     ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt tatgttattc
     tctctgtaaa ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt tcttatttgg
     attgggataa ataatatggc tgtttatttt gtaactggca aattaggctc tggaaagacg
     ctcgttagcg ttggtaagat tcaggataaa attgtagctg ggtgcaaaat agcaactaat
     cttgatttaa ggcttcaaaa cctcccgcaa gtcgggaggt tcgctaaaac gcctcgcgtt
     cttagaatac cggataagcc ttctatatct gatttgcttg ctattgggcg cggtaatgat
     tcctacgatg aaaataaaaa cggcttgctt gttctcgatg agtgcggtac ttggtttaat
     acccgttctt ggaatgataa ggaaagacag ccgattattg attggtttct acatgctcgt
     aaattaggat gggatattat ttttcttgtt caggacttat ctattgttga taaacaggcg
     cgttctgcat tagctgaaca tgttgtttat tgtcgtcgtc tggacagaat tactttacct
     tttgtcggta ctttatattc tcttattact ggctcgaaaa tgcctctgcc taaattacat
     gttggcgttg ttaaatatgg cgattctcaa ttaagcccta ctgttgagcg ttggctttat
     actggtaaga atttgtataa cgcatatgat actaaacagg ctttttctag taattatgat
     tccggtgttt attcttattt aacgccttat ttatcacacg gtcggtattt caaaccatta
     aatttaggtc agaagatgaa attaactaaa atatatttga aaaagttttc tcgcgttctt
     tgtcttgcga ttggatttgc atcagcattt acatatagtt atataaccca acctaagccg
     gaggttaaaa aggtagtctc tcagacctat gattttgata aattcactat tgactcttct
     cagcgtctta atctaagcta tcgctatgtt ttcaaggatt ctaagggaaa attaattaat
     agcgacgatt tacagaagca aggttattca ctcacatata ttgatttatg tactgtttcc
     attaaaaaag gtaattcaaa tgaaattgtt aaatgtaatt aattttgttt tcttgatgtt
     tgtttcatca tcttcttttg ctcaggtaat tgaaatgaat aattcgcctc tgcgcgattt
     tgtaacttgg tattcaaagc aatcaggcga atccgttatt gtttctcccg atgtaaaagg
     tactgttact gtatattcat ctgacgttaa acctgaaaat ctacgcaatt tctttatttc
     tgttttacgt gctaataatt ttgatatggt tggttcaatt ccttccataa ttcagaagta
     taatccaaac aatcaggatt atattgatga attgccatca tctgataatc aggaatatga
     tgataattcc gctccttctg gtggtttctt tgttccgcaa aatgataatg ttactcaaac
     ttttaaaatt aataacgttc gggcaaagga tttaatacga gttgtcgaat tgtttgtaaa
     gtctaatact tctaaatcct caaatgtatt atctattgac ggctctaatc tattagttgt
     tagtgcacct aaagatattt tagataacct tcctcaattc ctttctactg ttgatttgcc
     aactgaccag atattgattg agggtttgat atttgaggtt cagcaaggtg atgctttaga
     tttttcattt gctgctggct ctcagcgtgg cactgttgca ggcggtgtta atactgaccg
     cctcacctct gttttatctt ctgctggtgg ttcgttcggt atttttaatg gcgatgtttt
     agggctatca gttcgcgcat taaagactaa tagccattca aaaatattgt ctgtgccacg
     tattcttacg ctttcaggtc agaagggttc tatctctgtt ggccagaatg tcccttttat
     tactggtcgt gtgactggtg aatctgccaa tgtaaataat ccatttcaga cgattgagcg
     tcaaaatgta ggtatttcca tgagcgtttt tcctgttgca atggctggcg gtaatattgt
     tctggatatt accagcaagg ccgatagttt gagttcttct actcaggcaa gtgatgttat
     tactaatcaa agaagtattg ctacaacggt taatttgcgt gatggacaga ctcttttact
     cggtggcctc actgattata aaaacacttc tcaagattct ggcgtaccgt tcctgtctaa
     aatcccttta atcggcctcc tgtttagctc ccgctctgat tccaacgagg aaagcacgtt
     atacgtgctc gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg
     gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggaa ccaccatcaa
     acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg
     ccaggcggtg aagggcaatc agctgttgcc cgtctcgctg gtgaaaagaa aaaccaccct
     ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gaattcccgg
     gagagctcga tatcgcatgc ggtacctcta gaagaagctt gggatccgtc gacctgcagc
     aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt
     aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
     gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgctttgc ctggtttccg
     gcaccagaag cggtgccgga aagctggctg gagtgcgatc ttcctgaggc cgatacggtc
     gtcgtcccct caaactggca gatgcacggt tacgatgcgc ccatctacac caacgtaacc
     tatcccatta cggtcaatcc gccgtttgtt cccacggaga atccgacggg ttgttactcg
     ctcacattta atgttgatga aagctggcta caggaaggcc agacgcgaat tatttttgat
     ggcgttccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca
     aaatattaac gtttacaatt taaatatttg cttatacaat cttcctgttt ttggggcttt
     tctgattatc aaccggggta catatgattg acatgctagt tttacgatta ccgttcatcg
     attctcttgt ttgctccaga ctctcaggca atgacctgat agcctttgta gatctctcaa
     aaatagctac cctctccggc attaatttat cagctagaac ggttgaatat catattgatg
     gtgatttgac tgtctccggc ctttctcacc cttttgaatc tttacctaca cattactcag
     gcattgcatt taaaatatat gagggttcta aaaattttta tccttgcgtt gaaataaagg
     cttctcccgc aaaagtatta cagggtcata atgtttttgg tacaaccgat ttagctttat
     gctctgaggc tttattgctt aattttgcta attctttgcc ttgcctgtat gatttattgg
     atgtt
//