back Return to this vector's summary.
ID   P453       preliminary; circular DNA; SYN; 2778 BP.
XX
AC   IG8002;
XX
DT   01-DEC-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector p453 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   B13R from pUC18 & vaccinia spi-2 gene
RC   p19K from pUC18 & oligo, VV P19K promoter
RC   p453 from pUC18 & oligo, VV P11K late promoter/P7.5K early promoter
RC   p19KHygro from p19K & pHygro
RC   p453Hygro from p453 & pHygro
RC   p19KNeo from p19K & pSV2-neo
RC   p453Neo from p453 & pSV2-neo
RC   pSPI-2 from pUC18 & B13R, vaccinia spi-2 gene
RC   pLC301 from pLC18
RA   Zhou J., Crawford L., Sun X.Y., Frazer I.H.;
RT   "The hygromycin-resistance-encoding gene as a selection marker
RT   for vaccinia virus recombinants";
RL   Gene 107:307-312(1991).
XX
RN   [2]
RC   pMJ1, pMJ2 from pMM34 & oligo
RC   pMJ3 from pMJ1
RC   pMJ4 from pMJ2
RC   pMJ11 from pMJ3 & oligo
RC   pMJ35 from pMJ4 & oligo
RC   pMJ21 from pMJ4 & pMJ35 & oligo
RA   Davison A.J., Moss B.;
RT   "Structure of vacccinia virus early promoters";
RL   J. Mol. Biol. 210:749-769(1989).
XX
RN   [3]
RC   vMJ series from pMJ3
RC   vMJ series from pMJ4
RC   vMJ series from pMJ11
RC   vMJ series from pMJ35
RA   Davison A.J., Moss B.;
RT   "Structure of vacccinia virus late promoters";
RL   J. Mol. Biol. 210:771-784(1989).
XX
RN   [4]
RC   pSTH1 from pUC13 & vaccinia virus
RC   pGS124 from pSTH1 & vaccinia virus
RC   pYC15 from pGS124
RC   pYC16 from pYC15 & pGpt07/14
RC   pLC18, pLC19 from pYC16 & HPV-16 L1 gene
RC   pRK19/16L1 from pRK19 & HPV-16-pAT153
RC   pSX3 from pGpt07/14 & vaccinia virus
RC   pSX5 from pSX3
RA   Zhou J., Crawford L., McLean L., Sun X.Y., Stanley M., Almond N.,
RA   Smith G.L.;
RT   "Increased antibody responses to human papillomavirus type 16 L1
RT   protein expressed by recombinant vaccinia virus lacking serine
RT   protease inhibitor genes";
RL   J. Gen. Virol. 71:2185-2190(1990).
XX
RN   [5]
RC   pRK19 from vaccinia virus
RA   Kent R.K.;
RT   "The isolation and analysis of the vaccinia virus 4b promoter";
RL   Thesis [University of Cambridge] 0:0-0(1988).
XX
RN   [6]
RC   pGpt07/14 from vaccinia virus
RA   Boyle D.B., Coupar E.H.;
RT   "A dominant selectable marker for construction of recombinant
RT   poxviruses";
RL   Gene 65:123-128(1988).
XX
RN   [7]
RC   HPV-16-pAT153 from pAT153 & HPV-16 L1 gene
RA   Durst M., Gissmann L., Ikenburg H., Zur Hausen H.;
RT   "A papillomavirus DNA from a cervical carcinoma and its prevalence
RT   in cancer biopsy samples from different geographic regions";
RL   Proc. Natl. Acad. Sci. U.S.A. 80:3812-3815(1983).
XX
RN   [8]
RC   pMM34 from pBR328 & vaccinia virus tk gene
RA   Mackett M., Yilma T., Rose J.K., Moss B.;
RT   "Vaccinia virus recombinants: expression of VSV genes and
RT   protective immunization of mice and cattle";
RL   Science 227:433-435(1985).
XX
RN   [9]
RC   pSC8 from lacZ gene
RA   Chakrabarti S., Brechling K., Moss B.;
RT   "Vaccinia virus expression vector: coexpression of
RT   beta-galactosidase provides visual screening of recombinant virus
RT   plaques";
RL   Mol. Cell. Biol. 5:3403-3409(1985).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   VV = vaccinia virus
CC   NM (p453)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (vaccinia)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove KpnI-SacI/SstI 6bp 443..449,
FT                   \ MCS/2680bp
FT                   2. oligo KpnI-SacI/SstI 98bp
FT                   \ cccgagctcaaaaatatagtagaatttcattttgtttttttctatgctat
FT                   \ aaatagcttaaaaattgaaactattctaatttattgcacggtaccccc,
FT                   \ VV P11K late/P7.5K early prom
FT                   -> p453 2778bp"
FT   -               1..442
FT                   /note="pUC18 1..442 442bp
FT                   KpnI = GGTAC^C"
FT   -               443..540
FT                   /note="98bp
FT                   \ cccgagctcaaaaatatagtagaatttcattttgtttttttctatgctat
FT                   \ aaatagcttaaaaattgaaactattctaatttattgcacggtaccccc
FT                   SacI = SstI = GAGCT^C"
FT   -               541..2778
FT                   /note="pUC18 449..2686 2238bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2778 BP; 699 A; 693 C; 692 G; 694 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg
     actctagagg atccccgggt accccgagct caaaaatata gtagaatttc attttgtttt
     tttctatgct ataaatagct taaaaattga aactattcta atttattgca cggtaccccc
     cgaattcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
     cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct
     aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
     agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt
     ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
     ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca
     tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     tggcgctttc tcaaagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact
     atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
     acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta
     actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct
     tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt
     tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga
     tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
     tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat
     caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg
     cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
     agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag
     acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc
     gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag
     ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
     tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa
     ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga
     tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata
     attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca
     agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg
     ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg
     ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
     cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
     gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac
     tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca
     tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag
     tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta
     tcacgaggcc ctttcgtc
//