back Return to this vector's summary.
ID   PAMP10     preliminary; circular DNA; SYN; 4122 BP.
XX
AC   IG1311;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pAMP10 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Eckert K.A., Kunkle T.A.;
RT   "DNA polymerase fidelity and the polymerase chain reaction";
RL   PCR Meth. Appl. 1:17-24(1991).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAMP10)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (BRL)
CC   HO (E.coli)
CC   CP (high)
CC   FN (cloning)(expression)(transcription)
CC   SE ()
CC   PA (pSPORT1)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pSPORT1 remove NotI-SalI 21bp 233..254,
FT                   \ MCS 4088bp
FT                   2. oligo NotI-XmaIII-SalI 30bp
FT                   \ ggccgcctactactactaatgatgatgatg
FT                   -> pAMP10 4118bp"
FT   -               1..236
FT                   /note="pSPORT1 1..236 236bp
FT                   NotI = GC^GGCC GC
FT                   \              ggccgcctactactactaatgatgatgatg"
FT   -               237..266
FT                   /note="ggccgcctactactactaatgatgatgatg 30bp
FT                   \ ggccgcctactactactaatgatgatgatg
FT                   SalI =                         G^TCGAC"
FT   -               267..4122
FT                   /note="pSPORT1 254..4109 3856bp"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacZ gene"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   misc_binding    125..381
FT                   /note="MCS AatII-SphI-MluI-SunI-SnaBI-HindIII-BamHI-
FT                   XbaI-NotI-XmaIII-SalI/AccI-SmaI-EcoRI-Kpn2I-RsrII-
FT                   PinAI-KpnI-Sse8387I-PstI"
FT   promoter        complement(0..0)
FT                   /note="PRO bacteriophage T7"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacI repressor gene"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
XX
SQ   Sequence 4122 BP; 1007 A; 1066 C; 1063 G; 986 T; 0 other;
     cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta
     ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg
     ttttcccagt cacgacgttg taaaacgacg gccagtgaat tgaatttagg tgacactata
     gaagagctat gacgtcgcat gcacgcgtac gtaagcttgg atcctctaga gcggccggcc
     gcctactact actaatgatg atgatgtcga cccgggaatt ccggaccggt acctgcaggc
     gtaccagctt tccctatagt gagtcgtatt agagcttggc gtaatcatgg tcatagctgt
     ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa
     agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac
     tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg
     cggggagagg cggtttgcgt attgggcgcc agggtggttt ttcttttcac cagtgagacg
     ggcaacagct gattgccctt caccgcctgg ccctgagaga gttgcagcaa gcggtccacg
     ctggtttgcc ccagcaggcg aaaatcctgt ttgatggtgg ttgacggcgg gatataacat
     gagctgtctt cggtatcgtc gtatcccact accgagatat ccgcaccaac gcgcagcccg
     gactcggtaa tggcgcgcat tgcgcccagc gccatctgat cgttggcaac cagcatcgca
     gtgggaacga tgccctcatt cagcatttgc atggtttgtt gaaaaccgga catggcactc
     cagtcgcctt cccgttccgc tatcggctga atttgattgc gagtgagata tttatgccag
     ccagccagac gcagacgcgc cgagacagaa cttaatgggc ccgctaacag cgcgatttgc
     tggtgaccca atgcgaccag atgctccacg cccagtcgcg taccgtcttc atgggagaaa
     ataatactgt tgatgggtgt ctggtcagag acatcaagaa ataacgccgg aacattagtg
     caggcagctt ccacagcaat ggcatcctgg tcatccagcg gatagttaat gatcagccca
     ctgacccgtt gcgcgagaag attgtgcacc gccgctttac aggcttcgac gccgcttcgt
     tctaccatcg acaccaccac gctggcaccc agttgatcgg cgcgagattt aatcgccgcg
     acaatttgcg acggcgcgtg cagggccaga ctggaggtgg caacgccaat cagcaacgac
     tgtttgcccg ccagttgttg tgccacgcgg ttgggaatgt aattcagctc cgccatcgcc
     gcttccactt tttcccgcgt tttcgcagaa acgtggctgg cctggttcac cacgcgggaa
     acggtctgat aagagacacc ggcatactct gcgacatcgt ataacgttac tggtttcaca
     ttcaccaccc tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg
     cgccattcga tggtgtcaac gtaaatgccg cttcgccttc gcgcgcgaat tgcaagctct
     gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc
     ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
     ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
     agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
     taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
     cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
     tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
     gctttctcaa tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
     gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
     tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
     gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
     cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
     aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
     tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
     ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
     attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
     ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt
     ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa
     taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt
     tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     acctgaaatt gtaaacgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag
     ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac
     cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga
     ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc
     accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg
     gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa
     gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac
     caccacaccc gccgcgctta atgcgccgct acagggcgcg tc
//