back Return to this vector's summary.
ID   PAMP19     preliminary; circular DNA; SYN; 2721 BP.
XX
AC   IG9011;
XX
DT   01-FEB-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pAMP19 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Eckert K.A., Kunkle T.A.;
RT   "DNA polymerase fidelity and the polymerase chain reaction";
RL   PCR Meth. Appl. 1:17-24(1991).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAMP19)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (BRL)
CC   HO (E.coli)
CC   CP (high)
CC   FN (cloning)(expression)(transcription)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 remove BamHI-XbaI 6bp 418..424,
FT                   \ MCS 2680bp
FT                   2. oligo BamHI-MluI-SpeI-BglII-NcoI-NotI-XbaI 41bp
FT                   \ gatccaacgcgtactagtagagatctccatgggcggccgct
FT                   -> pAMP19 2721bp"
FT   -               1..417
FT                   /note="pUC19 1..417 417bp
FT                   BamHI = G^GATCC"
FT   -               418..458
FT                   /note="41bp
FT                   \ gatccaacgcgtactagtagagatctccatgggcggccgct
FT                   XbaI = T^CTAGA"
FT   -               459..2721
FT                   /note="pUC19 424..2686 2263bp"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacZ gene"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   misc_binding    364..535
FT                   /note="MCS EcoRI/ApoI-BanI/SstI-KpnI-SmaI/XmaI-BamHI-
FT                   MluI-SpeI-BglII-NcoI-NotI-XbaI-SalI/AccI-HincII-BspMI-
FT                   Sse8387I-PstI-SphI-HindIII"
FT   promoter        complement(0..0)
FT                   /note="PRO bacteriophage T7"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacI repressor gene"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
XX
SQ   Sequence 2721 BP; 674 A; 685 C; 697 G; 665 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat
     ccaacgcgta ctagtagaga tctccatggg cggccgctct agagtcgacc tgcaggcatg
     caagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa
     ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga
     gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt
     gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct
     cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
     cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
     acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
     ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
     ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
     gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
     gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
     ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
     actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
     gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
     ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
     ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
     gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
     tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
     tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
     aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
     aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
     tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
     gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
     agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
     aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag
     gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
     caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
     cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
     ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
     ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac
     gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
     cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
     gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
     caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
     tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
     acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
     aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
     gtatcacgag gccctttcgt c
//