back Return to this vector's summary.
ID   PAMP2      preliminary; circular DNA; SYN; 4114 BP.
AC   IG9003;
DT   01-FEB-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phagemid vector pAMP2 - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Rashtchian A., Thorton C.G., Heidecker G.;
RT   "A novel method for site-directed mutagenesis using PCR and uracil
RT   DNA glycosylase";
RL   PCR Meth. Appl. 2:124-130(1992).
RN   [2]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Higuchi R., Krummel B., Saiki R.K.;
RT   "A general method of in vitro preparation and specific mutagenesis
RT   of DNA fragments: study of protein and DNA interactions";
RL   Nucleic Acids Res. 16:7351-7367(1988).
RN   [3]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Owen J.L., Hay C., Schuster D.M., Rashtchian A.;
RT   ;
RL   Focus 16:39-39(1994).
RN   [4]
RC   [pAMP1, pAMP2, pAMP10 from pSPORT1 & oligo]
RC   [pAMP18 from pUC18 & oligo]
RC   [pAMP19 from pUC19 & oligo]
RA   Rashtchian A., Buchman G.W., Schuster D.M., Berninger M.S.;
RT   "Uracil DNA glycosylase-mediated cloning of polymerase chain
RT   reaction-amplified DNA: application to genomic and cDNA cloning";
RL   Anal. Biochem. 206:91-97(1992).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAMP2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   HO (E.coli)
CC   CP (high)
CC   FN (cloning)(expression)(transcription)
CC   SE ()
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pSPORT1 remove NotI-SalI 21bp 233..254,
FT                   \ MCS 4088bp
FT                   2. oligo NotI-XmaIII-SalI 30bp
FT                   \ ggccgcctactactactaatgatgatgatg
FT                   -> pAMP2 4118bp"
FT   -               1..232
FT                   /note="pSPORT1 1..232 232bp
FT                   NotI = GC^GGCCGC
FT                   \         catcatcatcattagtagtagtaggcggcc"
FT   -               233..262
FT                   /note="catcatcatcattagtagtagtaggcggcc 30bp
FT                   \ catcatcatcattagtagtagtaggcggcc
FT                   SalI =                    G^TCGA C"
FT   -               263..4114
FT                   /note="pSPORT1 258..4109 3852bp"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacZ gene"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   misc_binding    125..381
FT                   /note="MCS AatII-SphI-MluI-SunI-SnaBI-HindIII-BamHI-
FT                   XbaI-NotI-XmaIII-SalI/AccI-SmaI-EcoRI-Kpn2I-RsrII-
FT                   PinAI-KpnI-Sse8387I-PstI"
FT   promoter        complement(0..0)
FT                   /note="PRO bacteriophage T7"
FT   CDS             complement(0..0)
FT                   /note="REP E. coli lacI repressor gene"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
SQ   Sequence 4114 BP; 1006 A; 1063 C; 1060 G; 985 T; 0 other;
     cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta
     ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg
     ttttcccagt cacgacgttg taaaacgacg gccagtgaat tgaatttagg tgacactata
     gaagagctat gacgtcgcat gcacgcgtac gtaagcttgg atcctctaga gccatcatca
     tcattagtag tagtaggcgg cccccgggaa ttccggaccg gtacctgcag gcgtaccagc
     tttccctata gtgagtcgta ttagagcttg gcgtaatcat ggtcatagct gtttcctgtg
     tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa
     gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct
     ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga
     ggcggtttgc gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag
     ctgattgccc ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgctggtttg
     ccccagcagg cgaaaatcct gtttgatggt ggttgacggc gggatataac atgagctgtc
     ttcggtatcg tcgtatccca ctaccgagat atccgcacca acgcgcagcc cggactcggt
     aatggcgcgc attgcgccca gcgccatctg atcgttggca accagcatcg cagtgggaac
     gatgccctca ttcagcattt gcatggtttg ttgaaaaccg gacatggcac tccagtcgcc
     ttcccgttcc gctatcggct gaatttgatt gcgagtgaga tatttatgcc agccagccag
     acgcagacgc gccgagacag aacttaatgg gcccgctaac agcgcgattt gctggtgacc
     caatgcgacc agatgctcca cgcccagtcg cgtaccgtct tcatgggaga aaataatact
     gttgatgggt gtctggtcag agacatcaag aaataacgcc ggaacattag tgcaggcagc
     ttccacagca atggcatcct ggtcatccag cggatagtta atgatcagcc cactgacccg
     ttgcgcgaga agattgtgca ccgccgcttt acaggcttcg acgccgcttc gttctaccat
     cgacaccacc acgctggcac ccagttgatc ggcgcgagat ttaatcgccg cgacaatttg
     cgacggcgcg tgcagggcca gactggaggt ggcaacgcca atcagcaacg actgtttgcc
     cgccagttgt tgtgccacgc ggttgggaat gtaattcagc tccgccatcg ccgcttccac
     tttttcccgc gttttcgcag aaacgtggct ggcctggttc accacgcggg aaacggtctg
     ataagagaca ccggcatact ctgcgacatc gtataacgtt actggtttca cattcaccac
     cctgaattga ctctcttccg ggcgctatca tgccataccg cgaaaggttt tgcgccattc
     gatggtgtca acgtaaatgc cgcttcgcct tcgcgcgcga attgcaagct ctgcattaat
     gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc
     tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
     cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
     gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
     gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
     gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
     ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
     aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
     tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
     ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
     gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
     ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
     ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
     agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
     ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa
     aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta
     tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
     cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
     tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac
     cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
     ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta
     gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac
     gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
     gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
     gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
     tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
     aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc
     cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
     caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
     cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
     ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
     aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
     tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaaa
     ttgtaaacgt taatattttg ttaaaattcg cgttaaattt ttgttaaatc agctcatttt
     ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc aaaagaatag accgagatag
     ggttgagtgt tgttccagtt tggaacaaga gtccactatt aaagaacgtg gactccaacg
     tcaaagggcg aaaaaccgtc tatcagggcg atggcccact acgtgaacca tcaccctaat
     caagtttttt ggggtcgagg tgccgtaaag cactaaatcg gaaccctaaa gggagccccc
     gatttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg aagaaagcga
     aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta accaccacac
     ccgccgcgct taatgcgccg ctacagggcg cgtc