back Return to this vector's summary.
ID   PAR1032    preliminary; circular DNA; SYN; 4499 BP.
XX
AC   IG9868;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAR1032 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAR1032)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ ctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata, Tphi term
FT                   -> pAR939 4483bp
FT                   1. pAR939 BamHI 4483bp, T7 3' gene 10
FT                   fill in
FT                   EcoRV linker 6bp gatatc
FT                   -> pAR1032 4489bp"
FT   -               1..379
FT                   /note="pBR322 1..379 379bp
FT                   BamHI = G^GATC C
FT                   \              gatatcgatc"
FT   -               380..389
FT                   /note="gatatcgatc 10bp
FT                   \   gatatcgatc
FT                   BamHI = G^GATC C
FT                   HhaI =       G CG^C
FT                   \              cgctg..."
FT   -               390..513
FT                   /note="T7 24104..24227 124bp
FT                   \ cgctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata
FT                   \ ...ctata
FT                   HhaI = GCG^C
FT                   BamHI =  G^GATCC"
FT   -               514..4499
FT                   /note="pBR322 376..4361 3986bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4499 BP; 1020 A; 1242 C; 1172 G; 1065 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcg atatcgatcc gctgctaaca aagcccgaaa ggaagctgag
     ttggctgctg ccaccgctga gcaataacta gcataacccc ttggggcctc taaacgggtc
     ttgaggggtt ttttgctgaa aggaggaact atagatcctc tacgccggac gcatcgtggc
     cggcatcacc ggcgccacag gtgcggttgc tggcgcctat atcgccgaca tcaccgatgg
     ggaagatcgg gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg gtatggtggc
     aggccccgtg gccgggggac tgttgggcgc catctccttg catgcaccat tccttgcggc
     ggcggtgctc aacggcctca acctactact gggctgcttc ctaatgcagg agtcgcataa
     gggagagcgt cgaccgatgc ccttgagagc cttcaaccca gtcagctcct tccggtgggc
     gcggggcatg actatcgtcg ccgcacttat gactgtcttc tttatcatgc aactcgtagg
     acaggtgccg gcagcgctct gggtcatttt cggcgaggac cgctttcgct ggagcgcgac
     gatgatcggc ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc aagccttcgt
     cactggtccc gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc
     cgacgcgctg ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg ccttccccat
     tatgattctt ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag
     gcaggtagat gacgaccatc agggacagct tcaaggatcg ctcgcggctc ttaccagcct
     aacttcgatc actggaccgc tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg
     gaacgggttg gcatggattg taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg
     tcgcggtgca tggagccggg ccacctcgac ctgaatggaa gccggcggca cctcgctaac
     ggattcacca ctccaagaat tggagccaat caattcttgc ggagaactgt gaatgcgcaa
     accaaccctt ggcagaacat atccatcgcg tccgccatct ccagcagccg cacgcggcgc
     atctcgggca gcgttgggtc ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg
     acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc gatacgcgag
     cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc
     ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg caccattatg
     ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac atctgtatta
     acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat ccataccgcc
     agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt aacccgtatc
     gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa tcccccttac
     acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg ctttatcaga
     agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga acaggcagac
     atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct cgcgcgtttc
     ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg
     taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt
     cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg
     cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat
     gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc
     gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat
     ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca
     ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc
     atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc
     aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg
     gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta
     ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg
     ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac
     acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag
     gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat
     ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat
     ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc
     gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt
     ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct
     agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt
     ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc
     gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac
     catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat
     cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg
     cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata
     gtttgcgcaa cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg tcgtttggta
     tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt
     gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag
     tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa
     gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc
     gaccgagttg ctcttgcccg gcgtcaacac gggataatac cgcgccacat agcagaactt
     taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc
     tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta
     ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa
     taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca
     tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac
     aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta
     ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaagaa
//