back Return to this vector's summary.
ID   PAR1959    preliminary; circular DNA; SYN; 4417 BP.
XX
AC   IG9861;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAR1959 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAR1959)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 TaqI-XbaI 48bp 22880..22928, phi10
FT                   blunt end:blunt end
FT                   BamHI linker 10bp cgggatcccg:BamHI linker 10bp
FT                   \ cgggatcccg
FT                   -> pAR1959 4409bp"
FT   -               1..375
FT                   /note="pBR322 1..375 375bp
FT                   BamHI = G^GATCC
FT                   \         gatcccg"
FT   -               376..382
FT                   /note="gatcccg 7bp
FT                   \    gatcccg
FT                   TaqI =  T^CG A"
FT   -               383..428
FT                   /note="T7 22882..22927 46bp
FT                   \ gaaattaatacgactcactatagggagaccacaacggtttccctct
FT                   XbaI = T^CTAGA
FT                   \        cgg"
FT   -               429..431
FT                   /note="cgg 3bp
FT                   \     cgg
FT                   BamHI = G^GATCC"
FT   -               432..4417
FT                   /note="pBR322 376..4361 3986bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4417 BP; 999 A; 1226 C; 1146 G; 1046 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc cggaaattaa tacgactcac tatagggaga ccacaacggt
     ttccctctcg ggatcctcta cgccggacgc atcgtggccg gcatcaccgg cgccacaggt
     gcggttgctg gcgcctatat cgccgacatc accgatgggg aagatcgggc tcgccacttc
     gggctcatga gcgcttgttt cggcgtgggt atggtggcag gccccgtggc cgggggactg
     ttgggcgcca tctccttgca tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac
     ctactactgg gctgcttcct aatgcaggag tcgcataagg gagagcgtcg accgatgccc
     ttgagagcct tcaacccagt cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc
     gcacttatga ctgtcttctt tatcatgcaa ctcgtaggac aggtgccggc agcgctctgg
     gtcattttcg gcgaggaccg ctttcgctgg agcgcgacga tgatcggcct gtcgcttgcg
     gtattcggaa tcttgcacgc cctcgctcaa gccttcgtca ctggtcccgc caccaaacgt
     ttcggcgaga agcaggccat tatcgccggc atggcggccg acgcgctggg ctacgtcttg
     ctggcgttcg cgacgcgagg ctggatggcc ttccccatta tgattcttct cgcttccggc
     ggcatcggga tgcccgcgtt gcaggccatg ctgtccaggc aggtagatga cgaccatcag
     ggacagcttc aaggatcgct cgcggctctt accagcctaa cttcgatcac tggaccgctg
     atcgtcacgg cgatttatgc cgcctcggcg agcacatgga acgggttggc atggattgta
     ggcgccgccc tataccttgt ctgcctcccc gcgttgcgtc gcggtgcatg gagccgggcc
     acctcgacct gaatggaagc cggcggcacc tcgctaacgg attcaccact ccaagaattg
     gagccaatca attcttgcgg agaactgtga atgcgcaaac caacccttgg cagaacatat
     ccatcgcgtc cgccatctcc agcagccgca cgcggcgcat ctcgggcagc gttgggtcct
     ggccacgggt gcgcatgatc gtgctcctgt cgttgaggac ccggctaggc tggcggggtt
     gccttactgg ttagcagaat gaatcaccga tacgcgagcg aacgtgaagc gactgctgct
     gcaaaacgtc tgcgacctga gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa
     gtctggaaac gcggaagtca gcgccctgca ccattatgtt ccggatctgc atcgcaggat
     gctgctggct accctgtgga acacctacat ctgtattaac gaagcgctgg cattgaccct
     gagtgatttt tctctggtcc cgccgcatcc ataccgccag ttgtttaccc tcacaacgtt
     ccagtaaccg ggcatgttca tcatcagtaa cccgtatcgt gagcatcctc tctcgtttca
     tcggtatcat tacccccatg aacagaaatc ccccttacac ggaggcatca gtgaccaaac
     aggaaaaaac cgcccttaac atggcccgct ttatcagaag ccagacatta acgcttctgg
     agaaactcaa cgagctggac gcggatgaac aggcagacat ctgtgaatcg cttcacgacc
     acgctgatga gctttaccgc agctgcctcg cgcgtttcgg tgatgacggt gaaaacctct
     gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac
     aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt
     cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact
     gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat
     caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg
     agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc
     aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt
     gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag
     tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc
     cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc
     ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
     cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt
     atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc
     agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa
     gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa
     gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg
     tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
     agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg
     gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg
     aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt
     aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact
     ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat
     gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg
     aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg
     ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat
     tgctgcaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc
     ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt
     cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc
     agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga
     gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc
     gtcaacacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa
     acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta
     acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg
     agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg
     aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat
     gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt
     tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa
     aaataggcgt atcacgaggc cctttcgtct tcaagaa
//