back Return to this vector's summary.
ID   PAR2516    preliminary; circular DNA; SYN; 4501 BP.
XX
AC   IG9871;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAR2516 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAR2516)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ Tphi term
FT                   -> pAR939 4483bp
FT                   1. pAR939 BamHI 4483bp, pBR322 376..376
FT                   Klenow
FT                   BglII linker 8bp gagatctc
FT                   -> pAR2516 4491bp"
FT   -               1..379
FT                   /note="pBR322 1..379 379bp
FT                   BamHI = G^GATC C
FT                   \              gagatctcgatc"
FT   -               380..391
FT                   /note="gagatctcgatc 12bp
FT                   \ gagatctcgatc
FT                   \             cgctgcta..."
FT   -               392..515
FT                   /note="T7 24104..24227 124bp
FT                   \ cgctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata
FT                   \ ...ctata
FT                   HhaI = GCG^C
FT                   BamHI =  G^GATCC"
FT   -               516..4501
FT                   /note="pBR322 376..4361 3986bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4501 BP; 1020 A; 1243 C; 1173 G; 1065 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcg agatctcgat ccgctgctaa caaagcccga aaggaagctg
     agttggctgc tgccaccgct gagcaataac tagcataacc ccttggggcc tctaaacggg
     tcttgagggg ttttttgctg aaaggaggaa ctatagatcc tctacgccgg acgcatcgtg
     gccggcatca ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat
     ggggaagatc gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg
     gcaggccccg tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg
     gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat
     aagggagagc gtcgaccgat gcccttgaga gccttcaacc cagtcagctc cttccggtgg
     gcgcggggca tgactatcgt cgccgcactt atgactgtct tctttatcat gcaactcgta
     ggacaggtgc cggcagcgct ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg
     acgatgatcg gcctgtcgct tgcggtattc ggaatcttgc acgccctcgc tcaagccttc
     gtcactggtc ccgccaccaa acgtttcggc gagaagcagg ccattatcgc cggcatggcg
     gccgacgcgc tgggctacgt cttgctggcg ttcgcgacgc gaggctggat ggccttcccc
     attatgattc ttctcgcttc cggcggcatc gggatgcccg cgttgcaggc catgctgtcc
     aggcaggtag atgacgacca tcagggacag cttcaaggat cgctcgcggc tcttaccagc
     ctaacttcga tcactggacc gctgatcgtc acggcgattt atgccgcctc ggcgagcaca
     tggaacgggt tggcatggat tgtaggcgcc gccctatacc ttgtctgcct ccccgcgttg
     cgtcgcggtg catggagccg ggccacctcg acctgaatgg aagccggcgg cacctcgcta
     acggattcac cactccaaga attggagcca atcaattctt gcggagaact gtgaatgcgc
     aaaccaaccc ttggcagaac atatccatcg cgtccgccat ctccagcagc cgcacgcggc
     gcatctcggg cagcgttggg tcctggccac gggtgcgcat gatcgtgctc ctgtcgttga
     ggacccggct aggctggcgg ggttgcctta ctggttagca gaatgaatca ccgatacgcg
     agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac ctgagcaaca acatgaatgg
     tcttcggttt ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta
     tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct acatctgtat
     taacgaagcg ctggcattga ccctgagtga tttttctctg gtcccgccgc atccataccg
     ccagttgttt accctcacaa cgttccagta accgggcatg ttcatcatca gtaacccgta
     tcgtgagcat cctctctcgt ttcatcggta tcattacccc catgaacaga aatccccctt
     acacggaggc atcagtgacc aaacaggaaa aaaccgccct taacatggcc cgctttatca
     gaagccagac attaacgctt ctggagaaac tcaacgagct ggacgcggat gaacaggcag
     acatctgtga atcgcttcac gaccacgctg atgagcttta ccgcagctgc ctcgcgcgtt
     tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc
     tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt
     gtcggggcgc agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta
     tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag
     atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct
     gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
     atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc
     caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga
     gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata
     ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac
     cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg
     taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc
     cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag
     acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt
     aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt
     atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg
     atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac
     gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca
     gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac
     ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac
     ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt
     tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt
     accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt
     atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc
     cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa
     tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg
     tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt
     gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc
     agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt
     aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg
     gcgaccgagt tgctcttgcc cggcgtcaac acgggataat accgcgccac atagcagaac
     tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc
     gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt
     tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg
     aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag
     catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa
     acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat
     tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtcttcaaga
     a
//