back Return to this vector's summary.
ID   PAR939     preliminary; circular DNA; SYN; 4489 BP.
XX
AC   IG9860;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAR939 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pAR939)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ Tphi term
FT                   -> pAR939 4483bp"
FT   -               1..379
FT                   /note="pBR322 1..379 379bp
FT                   BamHI = G^GATC C
FT                   HhaI =       G CG^C
FT                   \              cgctg..."
FT   -               380..503
FT                   /note="T7 24104..24227 124bp
FT                   \ cgctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata
FT                   \ ...ctata
FT                   HhaI = GCG^C
FT                   BamHI =  G^GATCC"
FT   -               504..4489
FT                   /note="pBR322 376..4361 3986bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4489 BP; 1017 A; 1240 C; 1170 G; 1062 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc gctgctaaca aagcccgaaa ggaagctgag ttggctgctg
     ccaccgctga gcaataacta gcataacccc ttggggcctc taaacgggtc ttgaggggtt
     ttttgctgaa aggaggaact atagatcctc tacgccggac gcatcgtggc cggcatcacc
     ggcgccacag gtgcggttgc tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg
     gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg
     gccgggggac tgttgggcgc catctccttg catgcaccat tccttgcggc ggcggtgctc
     aacggcctca acctactact gggctgcttc ctaatgcagg agtcgcataa gggagagcgt
     cgaccgatgc ccttgagagc cttcaaccca gtcagctcct tccggtgggc gcggggcatg
     actatcgtcg ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg
     gcagcgctct gggtcatttt cggcgaggac cgctttcgct ggagcgcgac gatgatcggc
     ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc
     gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc cgacgcgctg
     ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg ccttccccat tatgattctt
     ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat
     gacgaccatc agggacagct tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc
     actggaccgc tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg gaacgggttg
     gcatggattg taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca
     tggagccggg ccacctcgac ctgaatggaa gccggcggca cctcgctaac ggattcacca
     ctccaagaat tggagccaat caattcttgc ggagaactgt gaatgcgcaa accaaccctt
     ggcagaacat atccatcgcg tccgccatct ccagcagccg cacgcggcgc atctcgggca
     gcgttgggtc ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg acccggctag
     gctggcgggg ttgccttact ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa
     gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc ttcggtttcc
     gtgtttcgta aagtctggaa acgcggaagt cagcgccctg caccattatg ttccggatct
     gcatcgcagg atgctgctgg ctaccctgtg gaacacctac atctgtatta acgaagcgct
     ggcattgacc ctgagtgatt tttctctggt cccgccgcat ccataccgcc agttgtttac
     cctcacaacg ttccagtaac cgggcatgtt catcatcagt aacccgtatc gtgagcatcc
     tctctcgttt catcggtatc attaccccca tgaacagaaa tcccccttac acggaggcat
     cagtgaccaa acaggaaaaa accgccctta acatggcccg ctttatcaga agccagacat
     taacgcttct ggagaaactc aacgagctgg acgcggatga acaggcagac atctgtgaat
     cgcttcacga ccacgctgat gagctttacc gcagctgcct cgcgcgtttc ggtgatgacg
     gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
     aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt
     tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc
     aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa
     aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
     tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc
     ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
     cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag
     ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga
     ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc
     gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
     agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg
     cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
     aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa
     aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa
     ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt
     aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag
     ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat
     agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc
     cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa
     ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca
     gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa
     cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
     cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc
     ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact
     catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc
     tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg
     ctcttgcccg gcgtcaacac gggataatac cgcgccacat agcagaactt taaaagtgct
     catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc
     cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag
     cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac
     acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg
     ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt
     tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac
     attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaagaa
//