back Return to this vector's summary.
ID   PAX4CP     preliminary; circular DNA; SYN; 6201 BP.
AC   IG1030;
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phagemid vector pAX4c+ - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   pAX1 from pSS20*c & oligo
RC   pAX2 from pAX1 & pSS9
RC   pAX3+, pAX3- from pAX2 & pEMBL8+
RC   pAX4+ from pAX3+
RC   pAX4- from pAX3+
RC   pAX4a+ from pAX4+ & linker
RC   pAX4b+ from pAX4+ & linker
RC   pAX4c+ from pAX4+ & linker
RC   pAX4a- from pAX4- & linker
RC   pAX4b- from pAX4- & linker
RC   pAX4c- from pAX4- & linker
RC   pAR10 from pAX1 & E.coli HisRS
RC   pPM3220 from pAX4+ & ILS1 gene
RA   Markmeyer P., Ruhlmann A., Englisch U., Cramer F.;
RT   "The pAX plasmids: new gene-fusion vectors for sequencing,
RT   mutagenesis and expression of proteins in Escherichia coli";
RL   Gene 93:129-134(1990).
CC   ATPG (para-aminophenyl-1-thio-beta-D-galactopyranoside) is like ITPG.
CC   Cleave away beta-galactosidase with collagenase or endoproteinase Xa.
CC   + makes non-coding strand. - makes coding strand.
CC   NM (pAX4c+)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (non-coding)
CC   TY (phagemid)
CC   HO (E.coli)
CC   CP ()
CC   FN (expression)
CC   SE (affinity ATPG)
CC   PA (pBR322)(f1)
CC   BR (pAX4a-)(pAX4a+)(pAX4b-)(pAX4b+)(pAX4c-)(pAX5+)(pAX5-)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   2. f1 1174bp
FT                   -> pSS20*c 5535bp
FT                   1. pSS20*c PstI 5535bp
FT                   2. oligo IEGR-Xa site-NruI-SalI 30bp
FT                   \ atcgagggtagggtcgcgatgtcgactgca
FT                   -> pAX1 5564bp
FT                   1. pAX1 remove HindIII-PstI, MCS/5573bp
FT                   2. pSS9 NruI-HindIII 84bp, stop codons
FT                   -> pAX2 5657bp
FT                   1. pAX2 DraII 5657bp, MCS
FT                   alkaline phosphatase
FT                   2. pEMBL8+ EcoRII-EcoRI 517bp 3651..3939..229,
FT                   \ MCS [514bp]
FT                   -> pAX3+ 6174bp
FT                   1. pAX3+ EcoRI 6174bp 0..0
FT                   mutagenesis
FT                   -> pAX3+-E5761 6174bp [no EcoRI in lacZ]
FT                   1. pAX3+-E5761 EcoRI 6174bp 0..0
FT                   Klenow
FT                   -> pAX4+ 6174bp [no EcoRI]
FT                   1. pAX4+ remove NruI-PstI 10bp, MCS/6164bp
FT                   2. linker NruI-PstI 37bp
FT                   \ accatggaattcggtaccagatctagagtcgactgca
FT                   -> pAX4c+ 6201bp"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1 intergenic region"
FT   misc_binding    145..145
FT                   /note="SIT unique NaeI"
FT   misc_binding    1030..1030
FT                   /note="SIT unique ScaI"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli tac (trp and lac)"
FT   misc_binding    2979..2979
FT                   /note="SIT unique Eco81I"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   misc_binding    3867..3867
FT                   /note="SIT unique EcoRV"
FT   misc_binding    4083..4083
FT                   /note="SIT unique BsaBI"
FT   misc_binding    4102..4102
FT                   /note="SIT unique BclI"
FT   misc_binding    4254..4254
FT                   /note="SIT unique BssHII"
FT   misc_binding    4589..4589
FT                   /note="SIT unique Eco47I"
FT   misc_binding    4692..4692
FT                   /note="SIT unique SacI"
FT   misc_feature    0..0
FT                   /note="collagen fragment (CS)"
FT   misc_binding    5712..5712
FT                   /note="SIT unique NdeI"
FT   misc_binding    5768..5768
FT                   /note="SIT unique EspI"
FT   misc_binding    5890..5890
FT                   /note="SIT unique PmlI"
FT   misc_binding    5984..5984
FT                   /note="SIT unique MscI"
FT   misc_binding    >5984..6021
FT                   /note="SIT endoproteinase Xa"
FT   misc_binding    6026..6163
FT                   /note="MCS unique NcoI-StyI-EcoRI-KpnI-BglII-
FT                   XbaI-PstI-SmaI-PacI-HindIII"
FT   terminator      6164..6201
FT                   /note="TER lambda long terminator t0"
SQ   Sequence 6201 BP; 1435 A; 1591 C; 1682 G; 1493 T; 0 other;
     ttcttgaaga cgaaagggca cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg
     gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc
     ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc
     cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt
     gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag
     tccacgttcg ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg
     gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag
     ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aatttaaata
     tttgcttata caatcttcct gtttttgggg cttttctgat tatcaaccgg ggtggcctcg
     tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg
     gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa
     atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga
     agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc
     ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg
     gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc
     gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat
     tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg
     acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag
     aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa
     cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc
     gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca
     cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc
     tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc
     tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg
     ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta
     tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag
     gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga
     ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc
     tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa
     agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa
     aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc
     cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt
     agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc
     tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac
     gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca
     gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcat tgagaaagcg
     ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag
     gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt
     ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat
     ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc
     acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt
     gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag
     cggaagagcg ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag
     ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag
     ttacctcact cattaggcac cccaggcttt acactttatg cttccggctc gtatgttgtg
     tggaattgtg agcggataac aatttcacac aggaaacagc tatgaccatg attacggatt
     cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc
     gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc
     gcccttccca acagttgcgc agcctgaatg gcgaatggcg ctttgcctgg tttccggcac
     cagaagcggt gccggaaagc tggctggagt gcgatcttcc tgaggccgat actgtcgtcg
     tcccctcaaa ctggcagatg cacggttacg atgcgcccat ctacaccaac gtaacctatc
     ccattacggt caatccgccg tttgttccca cggagaatcc gacgggttgt tactcgctca
     catttaatgt tgatgaaagc tggctacagg aaggccagac gcgaattatt tttgatggcg
     ttaactcggc gtttcatctg tggtgcaacg ggcgctgggt cggttacggc caggacagtc
     gtttgccgtc tgaatttgac ctgagcgcat ttttacgcgc cggagaaaac cgcctcgcgg
     tgatggtgct gcgttggagt gacggcagtt atctggaaga tcaggatatg tggcggatga
     gcggcatttt ccgtgacgtc tcgttgctgc ataaaccgac tacacaaatc agcgatttcc
     atgttgccac tcgctttaat gatgatttca gccgcgctgt actggaggct gaagttcaga
     tgtgcggcga gttgcgtgac tacctacggg taacagtttc tttatggcag ggtgaaacgc
     aggtcgccag cggcaccgcg cctttcggcg gtgaaattat cgatgagcgt ggtggttatg
     ccgatcgcgt cacactacgt ctgaacgtcg aaaacccgaa actgtggagc gccgaaatcc
     cgaatctcta tcgtgcggtg gttgaactgc acaccgccga cggcacgctg attgaagcag
     aagcctgcga tgtcggtttc cgcgaggtgc ggattgaaaa tggtctgctg ctgctgaacg
     gcaagccgtt gctgattcga ggcgttaacc gtcacgagca tcatcctctg catggtcagg
     tcatggatga gcagacgatg gtgcaggata tcctgctgat gaagcagaac aactttaacg
     ccgtgcgctg ttcgcattat ccgaaccatc cgctgtggta cacgctgtgc gaccgctacg
     gcctgtatgt ggtggatgaa gccaatattg aaacccacgg catggtgcca atgaatcgtc
     tgaccgatga tccgcgctgg ctaccggcga tgagcgaacg cgtaacgcga atggtgcagc
     gcgatcgtaa tcacccgagt gtgatcatct ggtcgctggg gaatgaatca ggccacggcg
     ctaatcacga cgcgctgtat cgctggatca aatctgtcga tccttcccgc ccggtgcagt
     atgaaggcgg cggagccgac accacggcca ccgatattat ttgcccgatg tacgcgcgcg
     tggatgaaga ccagcccttc ccggctgtgc cgaaatggtc catcaaaaaa tggctttcgc
     tacctggaga gacgcgcccg ctgatccttt gcgaatacgc ccacgcgatg ggtaacagtc
     ttggcggttt cgctaaatac tggcaggcgt ttcgtcagta tccccgttta cagggcggct
     tcgtctggga ctgggtggat cagtcgctga ttaaatatga tgaaaacggc aacccgtggt
     cggcttacgg cggtgatttt ggcgatacgc cgaacgatcg ccagttctgt atgaacggtc
     tggtctttgc cgaccgcacg ccgcatccag cgctgacgga agcaaaacac cagcagcagt
     ttttccagtt ccgtttatcc gggcaaacca tcgaagtgac cagcgaatac ctgttccgtc
     atagcgataa cgagctcctg cactggatgg tggcgctgga tggtaagccg ctggcaagcg
     gtgaagtgcc tctggatgtc gctccacaag gtaaacagtt gattgaactg cctgaactac
     cgcagccgga gagcgccggg caactctggc tcacagtacg cgtagtgcaa ccgaacgcga
     ccgcatggtc agaagccggg cacatcagcg cctggcagca gtggcgtctg gcggaaaacc
     tcagtgtgac gctccccgcc gcgtcccacg ccatcccgca tctgaccacc agcgaaatgg
     atttttgcat cgagctgggt aataagcgtt ggcaatttaa ccgccagtca ggctttcttt
     cacagatgtg gattggcgat aaaaaacaac tgctgacgcc gctgcgcgat cagttcaccc
     gtgcaccgct ggataacgac attggcgtaa gtgaagcgac ccgcattgac cctaacgcct
     gggtcgaacg ctggaaggcg gcgggccatt accaggccga agcagcgttg ttgcagtgca
     cggcagatac acttgctgat gcggtgctga ttacgaccgc tcacgcgtgg cagcatcagg
     ggaaaacctt atttatcagc cggaaaacct accggattga tggtagtggt caaatggcga
     ttaccgttga tgttgaagtg gcgagcgata caccgcatcc ggcgcggatt ggcctgaact
     gccagctggc gcaggtagca gagcgggtaa actggctcgg attagggccg caagaaaact
     atcccgaccg ccttactgcc gcctgttttg accgctggga tctgccattg tcagacatgt
     ataccccgta cgtcttcccg agcgaaaacg gtctgcgctg cgggacgcgc gaattgaatt
     atggcccaca ccagtggcgc ggcgacttcc agttcaacat cagccgctac agtcaacagc
     aactgatgga aaccagccat cgccatctgc tgcacgcgga agaaggcaca tggctgaata
     tcgacggttt ccatatgggg attggtggcg acgactcctg gagcccgtca gtatcggcgg
     tattccagct gagcgccggt cgctaccatt accagttggt ctggtgtcaa aaaggggatc
     ctggtcctgt tggtcctgtt ggtcctgctg gtgcttttgg cccaagaggt ctcgctggcc
     cacaaggtcc acgtggtgag aaaggtgaac ctggtgataa gggacataga ggtctgcctg
     gcctgaaggg acacaatgga ttgcagggtc ttcctggtct tgctggccaa catggtgatc
     cgcctgcaat cgagggtagg gtcgaccatg gaattcggta ccagatctag agtcgactgc
     agcccgggtg attgattgac gatgattaat taattcagaa cgctcggttg ccgccgggcg
     ttttttatgc agcaatggca agaacgttgc ccggatccgt cgaagcttat cgatgataag
     ctgtcaaaca tgaagaatta a