back Return to this vector's summary.
ID   PBD7       preliminary; circular DNA; SYN; 2913 BP.
XX
AC   X05337; X02396; K02560; IG5133;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBD7 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCB111 from coxsackievirus B3
RC   pC1B1 from pBD7 & pCB111
RC   pC11B9 from pC1B1 & oligo
RA   Dasmahapatra B.;
RT   "Cell-free expression vector: use of insect virus translational
RT   initiation signal for in vitro gene expression";
RL   Meth. Enzymol. 217:143-151(1993).
XX
RN   [2]
RP   1-79
RC   pBD7 from pGEM-2 & p1B9SP, BBV 5'UTR/ATG
RA   Dasmahapatra B., Rozhon E.J., Schwartz J.;
RT   "pBD7, a novel cell-free expression vector with efficient
RT   translation initiation signal";
RL   Nucleic Acids Res. 15:3933-3933(1987).
XX
RN   [3]
RC   pUC13::BBVRNA1 from pUC13 & BBV RNA 1
RC   pUC13::BBVRNA2 from pUC13 & BBV RNA 2
RC   p1B.SP series, p1B9SP, p1B13SP from pSP64 & pUC13::BBVRNA1
RC   p2B.SP series, p2B10SP, p2B48SP from pSP64 & pUC13::BBVRNA2
RC   p1B.PM series from pPM1 & pUC13::BBVRNA1
RC   p2B.PM series, p2B10PM8 from pPM1 & pUC13::BBVRNA2
RA   Dasmahapatra B., Dasgupta R., Saunders K., Selling B., Gallagher T.,
RA   Kaesberg P.;
RT   "Infectious RNA derived by transcription from cloned cDNA copies
RT   of the genomic RNA of an insect virus";
RL   Proc. Natl. Acad. Sci. U.S.A. 83:63-66(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 58256
CC   MCS plus UTR. oligonucleotide linker.
CC   NM (pBD7)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pGEM-2)(BBV)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC13 SmaI 2680bp 268..268, MCS
FT                   2. BBV
FT                   reverse transcriptase
FT                   PstI-XbaI, RNA 1
FT                   -> pUC13::BBVRNA1
FT                   1. pSP64 XbaI 2999bp 29..29
FT                   2. pUC13::BBVRNA1 PstI-XbaI, BBV RNA 1
FT                   -> p1B9SP
FT                   1. pGEM-2 remove EcoRI-PstI 40bp 11..51, MCS/2829bp
FT                   2. p1B9SP PstI-EcoRI 79bp
FT                   \ ctgcagttttcgaaacaaataaaacagaaaagcgaacctaaacaatgact
FT                   \ ctagaggatccccgggcgagctcgaattc, BBV 5'UTR/ATG
FT                   -> pBD7 2908bp"
FT   -               1..10
FT                   /note="pGEM-2 1..10 10bp
FT                   EcoRI = G^AATTC"
FT   -               11..94
FT                   /note="84bp
FT                   \ aattcgagctcgcccggggatcctctagagtcattgtttaggttcgcttt
FT                   \ tctgttttctgttttatttgtttcgaaaactgca
FT                   PstI = CTGCA^G"
FT   -               95..2913
FT                   /note="pGEM-2 51..2869 2819bp"
FT   CDS             0..0
FT                   /note="ANT E. coli amp gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO T7"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-PstI-BBV UTR-XbaI-BamHI-SmaI-
FT                   SacI-EcoRI"
FT   misc_feature    45..47
FT                   /note="insect virus translation initiation codon"
FT   promoter        0..0
FT                   /note="PRO Sp6"
XX
SQ   Sequence 2913 BP; 717 A; 746 C; 734 G; 716 T; 0 other;
     gaatacacgg aattcgagct cgcccgggga tcctctagag tcattgttta ggttcgcttt
     tctgttttct gttttatttg tttcgaaaac tgcagcccaa gcttccggtc tccctatagt
     gagtcgtatt aatttcgata agccagctgc attaatgaat cggccaacgc gcggggagag
     gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg
     ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat
     caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta
     aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa
     atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc
     cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt
     ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca
     gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg
     accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat
     cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta
     cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct
     gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac
     aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa
     aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa
     actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt
     taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca
     gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca
     tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc
     ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa
     accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc
     agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca
     acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat
     tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag
     cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac
     tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt
     ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt
     gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc
     tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat
     ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca
     gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga
     cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg
     gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg
     ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga
     cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg
     acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg
     atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct
     ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatc gacgctctcc
     cttatgcgac tcctgcatta ggaagcagcc cagtagtagg ttgaggccgt tgagcaccgc
     cgccgcaagg aatggtgcat gcaaggagat ggcgcccaac agtcccccgg ccacggggcc
     tgccaccata cccacgccga aacaagcgct catgagcccg aagtggcgag cccgatcttc
     cccatcggtg atgtcggcga tataggcgcc agcaaccgca cctgtggcgc cggtgatgcc
     ggccacgatg cgtccggcgt agaggatctg gctagcgatg accctgctga ttggttcgct
     gaccatttcc ggggtgcgga acggcgttac cagaaactca gaaggttcgt ccaaccaaac
     cgactctgac ggcagtttac gagagagatg atagggtctg cttcagtaag ccagatgcta
     cacaattagg cttgtacata ttgtcgttag aacgcggcta caattaatac ataaccttat
     gtatcataca catacgattt aggtgacact ata
//