back Return to this vector's summary.
ID   PBEND1     preliminary; circular DNA; SYN; 2565 BP.
XX
AC   IG9809;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBend1 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-242
RC   pJK14 from pBR322
RC   pBend1 from pJK14 & oligo
RC   plasmid a, plasmid b, plasmid c, plasmid d from pBend1 & oligo
RC   pBend2 from plasmid a & plasmid c
RC   from pJK14
RA   Kim J., Zwieb C., Wu C., Adhya S.;
RT   "Bending of DNA by gene-regulatory proteins: Construction and use of
RT   a DNA bending vector";
RL   Gene 85:15-23(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pBend1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove EcoRV-PvuII 1879bp 188..2067,
FT                   \ 2482bp
FT                   -> pJK14 2482bp
FT                   1. pJK14 remove EcoRI-HindIII 31bp,
FT                   \ pBR322 4360..4361..30/2451bp
FT                   2. oligo EcoRI-MluI-BglII-NheI-ClaI-StyI-SpeI-XhoI-
FT                   BamHI-XbaI-SalI-MluI-BglII-NheI-ClaI-StyI-SpeI-
FT                   XhoI-BamHI-HindIII 114bp [see sequence]
FT                   -> pBend1 2565bp"
FT   -               1..114
FT                   /note="114bp
FT                   \ aattcacgcgtagatctgctagcatcgatccatggactagtctcgaggga
FT                   \ tcctctagagtcgacacgcgtagatctgctagcatcgatccatggactag
FT                   \ tctcgagggatcca
FT                   \ ...gatcca
FT                   HindIII = A^AGCTT"
FT   -               115..272
FT                   /note="pBR322 30..187 158bp
FT                   EcoRV = GAT^ATC
FT                   PvuII = CAG^CTG"
FT   -               273..2565
FT                   /note="pBR322 2067..4359 2293bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   misc_binding    0..0
FT                   /note="MCS
FT                   EcoRI-MluI-BglII-NheI-ClaI-StyI-SpeI-XhoI-
FT                   BamHI-XbaI-SalI-MluI-BglII-NheI-ClaI-StyI-SpeI-
FT                   XhoI-BamHI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2565 BP; 642 A; 650 C; 638 G; 635 T; 0 other;
     aattcacgcg tagatctgct agcatcgatc catggactag tctcgaggga tcctctagag
     tcgacacgcg tagatctgct agcatcgatc catggactag tctcgaggga tccaagcttt
     aatgcggtag tttatcacag ttaaattgct aacgcagtca ggcaccgtgt atgaaatcta
     acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc ataggcttgg
     ttatgccggt actgccgggc ctcttgcggg atctgcctcg cgcgtttcgg tgatgacggt
     gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc
     gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc
     atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc
     agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa
     aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc
     ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag
     gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa
     aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc
     gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc
     ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg
     cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt
     cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc
     gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc
     cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag
     agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg
     ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa
     ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag
     gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact
     cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa
     attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt
     accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag
     ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca
     gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc
     agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt
     ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg
     ttgttgccat tgctgcaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca
     gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg
     ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca
     tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg
     tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct
     cttgcccggc gtcaacacgg gataataccg cgccacatag cagaacttta aaagtgctca
     tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca
     gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg
     tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac
     ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt
     attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc
     cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat
     taacctataa aaataggcgt atcacgaggc cctttcgtct tcaag
//