back Return to this vector's summary.
ID   PBEND2     preliminary; circular DNA; SYN; 2687 BP.
XX
AC   M33429;
XX
DT   15-SEP-1990 (Rel. 5, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBend2 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-242
RC   pJK14 from pBR322
RC   pBend1 from pJK14 & oligo
RC   plasmid a, plasmid b, plasmid c, plasmid d from pBend1 & oligo
RC   pBend2 from plasmid a & plasmid c
RC   from pJK14
RA   Kim J., Zwieb C., Wu C., Adhya S.;
RT   "Bending of DNA by gene-regulatory proteins: Construction and use of
RT   a DNA bending vector";
RL   Gene 85:15-23(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 208954
CC   NM (pBend2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove EcoRV-PvuII 1879bp 188..2067,
FT                   \ 2482bp
FT                   -> pJK14 2482bp
FT                   1. pJK14 remove EcoRI-HindIII 31bp,
FT                   \ pBR322 4360..4361..30/2451bp
FT                   2. oligo EcoRI-MluI-BglII-NheI-ClaI-StyI-SpeI-XhoI-
FT                   BamHI-XbaI-SalI-MluI-BglII-NheI-ClaI-StyI-SpeI-
FT                   XhoI-BamHI-HindIII 114bp [see sequence]
FT                   -> pBend1 2565bp
FT                   1. pBend1 XhoI 2565bp, 5' MCS
FT                   2. oligo XhoI-DraI-EcoRV-PvuII-SmaI-StuI-NruI-SspI-
FT                   RsaI-NcoI-XhoI* 61bp [see sequence]
FT                   -> plasmid a 2626bp [2 XhoI]
FT                   1. pBend1 XhoI 2565bp, 3' MCS
FT                   2. oligo XhoI-DraI-EcoRV-PvuII-SmaI-StuI-NruI-SspI-
FT                   RsaI-NcoI-XhoI* 61bp [see sequence]
FT                   -> plasmid c 2626bp [2 XhoI]
FT                   1. plasmid a small SalI-PstI, MCS to
FT                   \ pBR322 PstI 3612 amp
FT                   2. plasmid c large SalI-PstI, MCS to
FT                   \ pBR322 PstI 3612 amp
FT                   -> pBend2 2687bp [2 XhoI]"
FT   -               1..236
FT                   /note="236bp
FT                   \ aattcacgcgtagatctgctagcatcgatccatggactagtctcgagtt
FT                   \ taaagatatccagctgcccgggaggccttcgcgaaatattggtaccccat
FT                   \ ggaatcgagggatcctctagagtcgacacgcgtagatctgctagcatcga
FT                   \ tccatggactagtctcgagtttaaagatatccagctgcccgggaggcctt
FT                   \ cgcgaaatattggtaccccatggaatcgagggatcca
FT                   HindIII = A^AGCTT"
FT   -               237..394
FT                   /note="pBR322 30..187 158bp
FT                   EcoRV = GAT^ATC
FT                   PvuII = CAG^CTG"
FT   -               395..2687
FT                   /note="pBR322 2067..4359 2293bp
FT                   EcoRI = G^AATTC"
FT   misc_binding    0..0
FT                   /note="MCS
FT                   EcoRI-MluI-BglII-NheI-ClaI-StyI-SpeI-XhoI-
FT                   DraI-EcoRV-PvuII-SmaI-StuI-NruI-SspI-RsaI-NcoI-
FT                   BamHI-XbaI-SalI-MluI-BglII-NheI-ClaI-StyI-SpeI-
FT                   XhoI-DraI-EcoRV-PvuII-SmaI-StuI-NruI-SspI-
FT                   RsaI-NcoI-BamHI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2687 BP; 674 A; 680 C; 670 G; 663 T; 0 other;
     aattcacgcg tagatctgct agcatcgatc catggactag tctcgagttt aaagatatcc
     agctgcccgg gaggccttcg cgaaatattg gtaccccatg gaatcgaggg atcctctaga
     gtcgacacgc gtagatctgc tagcatcgat ccatggacta gtctcgagtt taaagatatc
     cagctgcccg ggaggccttc gcgaaatatt ggtaccccat ggaatcgagg gatccaagct
     ttaatgcggt agtttatcac agttaaattg ctaacgcagt caggcaccgt gtatgaaatc
     taacaatgcg ctcatcgtca tcctcggcac cgtcaccctg gatgctgtag gcataggctt
     ggttatgccg gtactgccgg gcctcttgcg ggatctgcct cgcgcgtttc ggtgatgacg
     gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
     aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt
     tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc
     aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa
     aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
     tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc
     ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
     cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag
     ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga
     ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc
     gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
     agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg
     cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
     aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa
     aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa
     ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt
     aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag
     ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat
     agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc
     cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa
     ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca
     gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa
     cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
     cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc
     ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact
     catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc
     tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg
     ctcttgcccg gcgtcaacac gggataatac cgcgccacat agcagaactt taaaagtgct
     catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc
     cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag
     cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac
     acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg
     ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt
     tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac
     attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaag
//