back Return to this vector's summary.
ID   PBK614     preliminary; circular DNA; SYN; 3323 BP.
XX
AC   IG5079;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBK614 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pBK605 from M13mp18 & sigmaVIII.1
RC   pBK608 from pBK605 & pBluescript KS+
RC   pBK610 from pBK608 & pBK605
RC   pBK614 from pBK610 & pBluescript KS+
RC   pUC18-ARG4 from pUC18 & ARG4 gene
RC   pBK615 from pBK614 & pUC18-ARG4
RC   pBK617 from pBK614 & pHS113
RA   Kudla B., Nicolas A.;
RT   "A multisite integrative cassette for the yeast Saccharomyces
RT   cerevisiae";
RL   Gene 119:49-56(1992).
XX
RN   [2]
RC   p(SPO13)1 from YCp19 & yeast SPO13 gene
RC   p(SPO13)2 from YCp19 & yeast SPO13 gene
RC   p(SPO13)3 from YCp50 & yeast SPO13 gene
RC   p(SPO13)4 from YCp19 & yeast SPO13 gene
RC   p(SPO13)5 from YCp50 & yeast SPO13 gene
RC   p(SPO13)6 from YCp50 & yeast SPO13 gene
RC   p(SPO13)7 from YCp50 & yeast SPO13 gene
RC   p(SPO13)8 from YCp50 & yeast SPO13 gene
RC   p(SPO13)9 from YCp50 & yeast SPO13 gene
RC   p(SPO13)10 from YCp19 & yeast SPO13 gene
RC   p(SPO13)11 from p(SPO13)8 & pBR322
RC   p(SPO13)12 from p(SPO13)6 & pBR322
RC   p(spo13)15 from p(SPO13)12 & linker & URA3 gene
RC   p(spo13)16 from p(SPO13)12 & linker & URA3 gene
RC   p(spo13)21 from p(SPO13)11 & linker & URA3 gene
RA   Wang H.T., Frackman S., Kowalisyn J., Esposito R.E., Elder R.T.;
RT   "Developmental regulation of SPO13, a gene required for separation
RT   of homologous chromosomes at meiosis I";
RL   Mol. Cell. Biol. 7:1425-1435(1987).
XX
RN   [3]
RC   pHS113 from URA3 gene
RA   Sun H.;
RT   ;
RL   Unpublished (1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   oligonucleotide cassette.
CC   NM (pBK614)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pSPO13-2)(pBluescript KS+)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. yeast chromosome 8 EcoRI-BglII, sigma
FT                   ClaI-HindIII 320bp, sigma
FT                   2. oligo SpeI-EagI-ClaI 48bp actagtcggccgat
FT                   \ cgatgttgtattacgggctcgagtaataccggag
FT                   3. oligo XbaI-SalI-HindIII 39bp gtctagagtcgacaagctt
FT                   \ gttgtatctcaaaatgagat
FT                   -> sigmaVIII.1 cassette 407bp
FT                   1. M13mp18 remove XbaI-SalI 6bp 6258..6264, MCS 7243bp
FT                   2. sigmaVIII.1 cassette SpeI-SalI 377bp, sigma
FT                   -> pBK605 7620bp
FT                   1. pBK605
FT                   mutagenesis to BalI and StuI, left half of sigma
FT                   SmaI-StuI, left half of sigma
FT                   2. pBluescript KS+ SmaI 2964bp 698..698, MCS
FT                   -> pBK608
FT                   1. pBK605
FT                   mutagenesis to BalI and StuI, right half of sigma
FT                   SalI-StuI, right half of sigma
FT                   2. pBK608 HindIII 7800bp 720..720, MCS
FT                   Klenow
FT                   SalI 7800bp 735..735, MCS
FT                   -> pBK610 8000bp
FT                   1. pBluescript KS+ remove SmaI-EcoRV 18bp 698..716,
FT                   \ MCS 2946bp
FT                   -> plasmid 2946bp
FT                   1. pBK610 ClaI-ClaI 377bp, sigma
FT                   \ cgatgttgtattacgggctcgagtaataccggagtgtcttgacaatcctaat
FT                   \ ctgaacagtcttagggaagtaaccagttgtcaaaacggtttatcagatta
FT                   \ attcacggaatgttacttatcttatatattatataaaatatgaatcatac
FT                   \ taagtggccaaagagggggctgcaggaattcgatatcaagctcctatctc
FT                   \ ggatctaaactaattgttcaggcatttatacttttgggtagttcagctag
FT                   \ ggaaggacggcttttgtctcatgttgttcgttttgttataaggttgtttc
FT                   \ atatgtgttttatgaacgtttaggatgacgtattgtcatactgacgtatc
FT                   \ tcattttgagatacaacaagcttat
FT                   2. plasmid ClaI 2946bp 727..727
FT                   -> pBK614 3323bp"
FT   -               1..697
FT                   /note="pBluescript KS+ 1..697 697bp
FT                   SmaI = XmaI = CCC^GGG
FT                   EcoRV =       GAT^ATC"
FT   -               698..708
FT                   /note="pBluescript KS+ 716..726 11bp
FT                   ClaI = AT^CGAT"
FT   -               709..1085
FT                   /note="377bp
FT                   \ cgatgttgtattacgggctcgagtaataccggagtgtcttgacaatcctaat
FT                   \ ctgaacagtcttagggaagtaaccagttgtcaaaacggtttatcagatta
FT                   \ attcacggaatgttacttatcttatatattatataaaatatgaatcatac
FT                   \ taagtggccaaagagggggctgcaggaattcgatatcaagctcctatctc
FT                   \ ggatctaaactaattgttcaggcatttatacttttgggtagttcagctag
FT                   \ ggaaggacggcttttgtctcatgttgttcgttttgttataaggttgtttc
FT                   \ atatgtgttttatgaacgtttaggatgacgtattgtcatactgacgtatc
FT                   \ tcattttgagatacaacaagcttat
FT                   ClaI = AT^CGAT"
FT   -               1086..3323
FT                   /note="pBluescript KS+ 727..2964 2238bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3323 BP; 852 A; 791 C; 829 G; 851 T; 0 other;
     ggaaattgta aacgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc
     attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga
     gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc
     caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc
     ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag
     cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa
     agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac
     cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcg cgccattcgc cattcaggct
     gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa
     agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg
     ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tggagctcca
     ccgcggtggc ggccgctcta gaactagtgg atcccccatc aagcttatcg atgttgtatt
     acgggctcga gtaataccgg agtgtcttga caatcctaat ctgaacagtc ttagggaagt
     aaccagttgt caaaacggtt tatcagatta attcacggaa tgttacttat cttatatatt
     atataaaata tgaatcatac taagtggcca aagagggggc tgcaggaatt cgatatcaag
     ctcctatctc ggatctaaac taattgttca ggcatttata cttttgggta gttcagctag
     ggaaggacgg cttttgtctc atgttgttcg ttttgttata aggttgtttc atatgtgttt
     tatgaacgtt taggatgacg tattgtcata ctgacgtatc tcattttgag atacaacaag
     cttatcgata ccgtcgacct cgaggggggg cccggtaccc agcttttgtt ccctttagtg
     agggttaatt ccgagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta
     tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc
     ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg
     aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg
     tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg
     gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa
     cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc
     gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc
     aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag
     ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct
     cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta
     ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc
     cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc
     agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt
     gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct
     gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc
     tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca
     agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta
     agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa
     atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg
     cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg
     actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc
     aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc
     cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa
     ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc
     cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg
     ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc
     cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat
     ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg
     tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc
     ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg
     aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat
     gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg
     gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg
     ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct
     catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac
     atttccccga aaagtgccac ctg
//