back Return to this vector's summary.
ID   PBLUESKM   preliminary; circular DNA; SYN; 2958 BP.
AC   X52324;
DT   10-MAY-1990 (Rel. 5, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phagemid vector pBluescript SK(-) - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-2958
RC   pBluescript SK(-)
RA   Thomas E.A.;
RT   ;
RL   Submitted (20-FEB-1990) on tape to the EMBL Data Library by:
RL   Thomas E.A., Stratagene Cloning Systems,
RL   11099 North Torrey Pines Rd., La Jolla, CA 92037, USA.
RN   [2]
RC   pJF3 from pUC19 & T7 oligo
RC   pBS or BlueScribe from pJF3 & T3 oligo
RC   pBS+, pBS- from pBS or BlueScribe & pEMBL8
RC   pBluescript KS(+) from pBS+ & linker
RC   pBluescript KS(-) from pBS- & linker
RC   pBluescript, pBluescript KS, pBluescript SK from pBS
RC   pBST-B from pBS & pEMBL8
RC   pBSITO#12 from pBST-B & pEMBL8
RC   pPreB from pBSITO#12 & pBluescript SK(-)
RC   lambda cI857 Sam7, lambda cI857 Sam100 nin5 from lambda
RC   lambda LongC from lambda cI857 Sam7 & pUC19 & lambda cI857 Sam100 nin5
RC   lambda LongD from lambda LongC
RC   lambda ZAP from lambda L47.1 & pPreB & lambda LongD
RA   Short J.M., Fernandez J.M., Sorge J.A., Huse W.D.;
RT   "Lambda ZAP: a bacteriophage lambda expression vector with in vivo
RT   excision properties";
RL   Nucleic Acids Res. 16:7583-7600(1988).
CC   The SK designation indicates the polylinker is oriented such
CC   that beta-galactosidase (lacZ) transcription proceeds through the SacI
CC   site first and the KpnI site last.
CC   pBluescript SK(-) carries an F1 origin of replication,
CC   oriented such that transcription proceeds in
CC   the opposite direction as beta-galactosidase transcription.
CC   NM (pBluescript SK-)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (non-coding)
CC   TY (phagemid)
CC   SP (Stratagene)
CC   HO (E.coli)
CC   CP ()
CC   FN (mapping gene)(expression)
CC   SE (color blue/white)
CC   PA (pUC19)(lambda ZAP)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBS- remove EcoRI-HindIII 51bp 882..933,
FT                   \ MCS/3153bp
FT                   Klenow:Klenow
FT                   linker SacI-KpnI 275bp
FT                   \ ggaaacagctatgaccatgattacgccaagctcgaaatta
FT                   \ accctcactaaagggaacaaaagctggagctccaccgcggtggcggccgc
FT                   \ tctagaactagtggatcccccgggctgcaggaattcgatatcaagcttat
FT                   \ cgataccgtcgacctcgaggggggcccggtacccaattcgccctatagtg
FT                   \ agtcgtattacaattcactggccgtcgttttacaa
FT                   -> pBluescript SK- 2958bp"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1 intergenic region"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T3"
FT   misc_binding    0..0
FT                   /note="MCS (21 unique restriction sites)"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
SQ   Sequence 2958 BP; 707 A; 755 C; 730 G; 766 T; 0 other;
     cacctgacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg
     tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc
     tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc
     gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta
     gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta
     atagtggact cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg
     atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa
     aatttaacgc gaattttaac aaaatattaa cgcttacaat ttccattcgc cattcaggct
     gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa
     agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg
     ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccgg
     gccccccctc gaggtcgacg gtatcgataa gcttgatatc gaattcctgc agcccggggg
     atccactagt tctagagcgg ccgccaccgc ggtggagctc cagcttttgt tccctttagt
     gagggttaat ttcgagcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt
     atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
     cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg
     gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
     gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     catttccccg aaaagtgc