back Return to this vector's summary.
ID   PBR327PAR  preliminary; circular DNA; SYN; 3668 BP.
XX
AC   L08857; VB0006;
XX
DT   04-JUN-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBR327par - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-3668
RC   pBR327par from pBR327
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [2]
RC   pdelta37 from pXJ002
RC   pdelta37ori from pSC101 & pdelta37
RC   M13mp7-par1, M13mp7-par2 from pdelta37ori & M13mp7
RC   pdelta37par from M13mp7-par1 & pdelta37
RC   pBR327par from pBR327 & pdelta37par
RA   Zurita M., Bolivar F., Soberon X.;
RT   "Construction and characterization of new cloning vehicles:
RT   VII. Construction of plasmid pBR327par, a completely
RT   sequenced, stable derivatieve of pBR327 containing the par
RT   locus of pSC101";
RL   Gene 28:119-122(1984).
XX
RN   [3]
RC   from pPM30
RC   from pPM31
RA   Miller C.A., Tucker W.T., Meacock P.A.,
RA   Gustafsson P., Cohen S.N.;
RT   "Nucleotide sequence of the partition locus of Escherichia
RT   coli plasmid pSC101";
RL   Gene 24:309-315(1983).
XX
RN   [4]
RC   pTU1 from pACYC184 & pSC101
RC   pPM20 from pTU1 & pSC105
RC   pPM21 from pTU1 & pBGP100
RC   pPM22, pPM23 from pSC101 & pDB11
RC   pPM24 from pPM20
RC   pPM25, pPM26, pPM27, pPM28, pPM29 from pPM22
RC   pSC120, pSC175, pSC197 from pSC101 & Tn3
RC   pSC203 from pSC201 & Tn3
RC   pPM30 from pTU1 & pPM22
RC   pPM31 from pACYC184 & pPM22
RC   pPM32 from pPM22 & pPM31
RC   pPM33 from pPM23 & pPM31
RC   [pOU491 from pSC101]
RA   Meacock P.A., Cohen S.N.;
RT   "Partitioning of bacterial plasmids during cell division. A
RT   cis-acting locus that accompanies stable plasmid inheritance in
RT   cell populations";
RL   Cell 20:529-542(1980).
XX
RN   [5]
RC   pPR001 from pBR327 & oligo, prokaryotic promoter
RC   pPR002 from pPR001
RC   pJR011 from pBR327, tet gene
RC   pXJ001 from pJR011 & oligo, prokaryotic promoter
RC   pXJ002 from pXJ001 & pCM7, cat gene
RC   pYJ026 from pXJ002
RA   Soberon X., Rossi J.J., Larson G.P., Itakura K.;
RT   "A synthetic, consensus sequence, prokaryotic promoter is functional";
RL   Promoters Structure and Function 0:407-431(1982).
RL   Rodriguez R.L., Chamberlin M.J.;
RL   Praeger Scientific, New York.
XX
RN   [6]
RC   pDB11 from RSF1050
RA   Sninsky J.J., Meacock P.A.;
RT   ;
RL   Unpublished (1980).
XX
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC
CC   Assembled by F. Pfeiffer, MPI, Martinsried
CC   Revised 16-DEC-1986 by F. Pfeiffer:
CC   Plasmid pBR327par was constructed by inserting a DNA fragment
CC   derived from plasmid pSC101 containing the partition (par)
CC   region into the AvaI site of plasmid pBR327.  The new cloning vehicle
CC   has all the cloning properties of the parental plasmid, and is more
CC   stable than pBR327.
CC   For the sequences of the pBR327/pSC101 borders see GenBank
CC   entries pBR327p1 and pBR327p2.
CC   NM (pBR327par)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR327)(pBR327p1)(pBR327p2)(pSC101C)(M12801)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR327 HindIII 3273bp 30..30
FT                   BAL31 nuclease, to remove tet -10 region
FT                   HindIII linker 6bp aagctt
FT                   -> pJR011 3200bp
FT                   1. pJR011 remove EcoRI-HindIII 31bp 3272..3273..30,
FT                   \ tet promoter/3200bp
FT                   2. oligo EcoRI-HindIII 26bp tataatgtattcccaagcttggcggt
FT                   -> pXJ001 3200bp
FT                   1. pXJ001 HindIII 3200bp 30..30
FT                   2. pCM7 HindIII-HindIII 787bp 30..817,
FT                   \ tet gene [791bp]
FT                   -> pXJ002 4000bp
FT                   1. pXJ002 remove HpaI-HpaI 780bp, tet gene/3300bp
FT                   -> pdelta37 3300bp
FT                   1. pSC101 1500bp, ori/par region
FT                   2. pdelta37 HindIII 3300bp, pBR327 30..30
FT                   -> pdelta37ori 4800bp
FT                   1. pdelta37ori AvaI-HincII 369bp, par region
FT                   Klenow:Klenow
FT                   2. M13mp7 remove HincII-HincII 12bp 6249..6261, 7226bp
FT                   -> M13mp7-par1 7595bp
FT                   1. M13mp7-par1 EcoRI-EcoRI 411bp, par region
FT                   \ M13mp7 6232..-..6274
FT                   2. pdelta37 EcoRI 3300bp
FT                   -> pdelta37par 3700bp
FT                   1. pBR327 AvaI 3273bp 1425..1425
FT                   2. pdelta37par BamHI-BamHI 393bp, par region
FT                   \ M13mp7 6241..-..6265
FT                   blunt end:blunt end
FT                   -> pBR327par 3668bp"
FT   misc_feature    1..1430
FT                   /note="from pBR327"
FT   CDS             86..1276
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
FT   misc_feature    1445..1811
FT                   /note="from pSC101par"
FT   misc_feature    1445..1812
FT                   /note="from pSC101"
FT   misc_feature    1817..3668
FT                   /note="from pBR327"
FT   CDS             complement(2603..3391)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 3668 BP; 831 A; 1008 C; 942 G; 887 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac
     aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca
     cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg
     actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct
     caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaccgat
     gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt
     cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct
     ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct
     tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa
     acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccgacgcgc tgggctacgt
     cttgctggcg ttcgcgacgc gaggctggat ggccttcccc attatgattc ttctcgcttc
     cggcggcatc gggatgcccg cgttgcaggc catgctgtcc aggcaggtag atgacgacca
     tcagggacag cttcaaggat cgctcgcggc tcttaccagc ctaacttcga tcactggacc
     gctgatcgtc acggcgattt atgccgcctc ggcgagcaca tggaacgggt tggcatggat
     tgtaggcgcc gccctatacc ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg
     ggccacctcg acctgaatgg aagccggcgg cacctcgcta acggattcac cactccaaga
     attggagcca atcaattctt gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac
     atatccatcg cgtccgccat ctccagcagc cgcacgcggc gcatctcggg atccgtcagc
     ttgggacagt aagacgggta agcctgttga tgataccgct gccttactgg gtgcattagc
     cagtctgaat gacctgtcac gggataatcc gaagtggtca gactggaaaa tcagagggca
     ggaactgcga acagcaaaaa gtcagatagc accacatagc agacccgcca taaaacgccc
     tgagagcccg tgacgggctt ttcttgtatt atgggtagtt tccttgcatg aatccataaa
     aggcgcctgt agtgccattt acccccattc actgccagag ccgtgagcgc agcgaactga
     atgtcacgaa aaagacagcg actcaggtgc ctgatggtcg gagacaaaag gaatattcag
     cgatttgccc gaacggatct cgggccgcgt tgctggcgtt tttccatagg ctccgccccc
     ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat
     aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc
     cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct
     cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg
     aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc
     cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga
     ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa
     ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta
     gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc
     agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg
     acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga
     tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg
     agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct
     gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg
     agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc
     cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa
     ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc
     cagttaatag tttgcgcaac gttgttgcca ttgctgcagg catcgtggtg tcacgctcgt
     cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc
     ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt
     tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc
     catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt
     gtatgcggcg accgagttgc tcttgcccgg cgtcaacacg ggataatacc gcgccacata
     gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga
     tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag
     catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa
     aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt
     attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga
     aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag
     aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc
     ttcaagaa
//