back Return to this vector's summary.
ID   PBRS206    preliminary; circular DNA; SYN; 4448 BP.
XX
AC   IG9862;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBRS206 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pBRS206 from pBRS188 & pOP1, lambda immunity region
RC   pBRS242 from pBR322 & pBRS206
RC   pBRS240 from pBRS242
RC   pBRS246 from pBRS240
RC   pBRS2843, pBRS2852 from pBRS240
RC   pBRS2845, pBRS2846, pBRS2850 from pBRS240
RC   pBRS3077 from pBRS240
RC   pBRS2950 from pBRS240
RC   pBRS2849 from pBRS240
RC   pBRS2343 from pBRS188
RA   Savochkina L.P., Retchinsky V.O., Bibilashvili R.S.;
RT   "Stability of cloned promoter-containing fragments";
RL   Mol. Gen. Genet. 189:142-147(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pBRS206)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(promoter analysis)
CC   SE ()
CC   PA (pBR322)(lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBRS188 EcoRI 4349bp, pBR322 4360..4360
FT                   2. E. coli EcoRI-EcoRI 99bp, lacUV5 promoter [104bp]
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> pBRS206 4448bp"
FT   -               1..26
FT                   /note="pBR322 1..26 26bp"
FT   -               27..4347
FT                   /note="pBR322 39..4359 4321bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               4348..4446
FT                   /note="99bp
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ ...aacag
FT                   EcoRI =  G^AATTC"
FT   -               4447..4448
FT                   /note="pBR322 4360..4361 2bp"
FT   misc_recomb     38..39
FT                   /note="pBR322 DNA end/EcoRI linker start; 5'"
FT   misc_recomb     5..6
FT                   /note="EcoRI linker end/pBR322 DNA start; 3'"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7 A2 or A3 promoter"
FT   promoter        0..0
FT                   /note="PRO bacteriophage lambda"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
XX
SQ   Sequence 4448 BP; 1006 A; 1232 C; 1153 G; 1057 T; 0 other;
     ttctcatgtt tgacagctta tcatcggcgg tagtttatca cagttaaatt gctaacgcag
     tcaggcaccg tgtatgaaat ctaacaatgc gctcatcgtc atcctcggca ccgtcaccct
     ggatgctgta ggcataggct tggttatgcc ggtactgccg ggcctcttgc gggatatcgt
     ccattccgac agcatcgcca gtcactatgg cgtgctgcta gcgctatatg cgttgatgca
     atttctatgc gcacccgttc tcggagcact gtccgaccgc tttggccgcc gcccagtcct
     gctcgcttcg ctacttggag ccactatcga ctacgcgatc atggcgacca cacccgtcct
     gtggatcctc tacgccggac gcatcgtggc cggcatcacc ggcgccacag gtgcggttgc
     tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg gctcgccact tcgggctcat
     gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg gccgggggac tgttgggcgc
     catctccttg catgcaccat tccttgcggc ggcggtgctc aacggcctca acctactact
     gggctgcttc ctaatgcagg agtcgcataa gggagagcgt cgaccgatgc ccttgagagc
     cttcaaccca gtcagctcct tccggtgggc gcggggcatg actatcgtcg ccgcacttat
     gactgtcttc tttatcatgc aactcgtagg acaggtgccg gcagcgctct gggtcatttt
     cggcgaggac cgctttcgct ggagcgcgac gatgatcggc ctgtcgcttg cggtattcgg
     aatcttgcac gccctcgctc aagccttcgt cactggtccc gccaccaaac gtttcggcga
     gaagcaggcc attatcgccg gcatggcggc cgacgcgctg ggctacgtct tgctggcgtt
     cgcgacgcga ggctggatgg ccttccccat tatgattctt ctcgcttccg gcggcatcgg
     gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat gacgaccatc agggacagct
     tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc actggaccgc tgatcgtcac
     ggcgatttat gccgcctcgg cgagcacatg gaacgggttg gcatggattg taggcgccgc
     cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca tggagccggg ccacctcgac
     ctgaatggaa gccggcggca cctcgctaac ggattcacca ctccaagaat tggagccaat
     caattcttgc ggagaactgt gaatgcgcaa accaaccctt ggcagaacat atccatcgcg
     tccgccatct ccagcagccg cacgcggcgc atctcgggca gcgttgggtc ctggccacgg
     gtgcgcatga tcgtgctcct gtcgttgagg acccggctag gctggcgggg ttgccttact
     ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg
     tctgcgacct gagcaacaac atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa
     acgcggaagt cagcgccctg caccattatg ttccggatct gcatcgcagg atgctgctgg
     ctaccctgtg gaacacctac atctgtatta acgaagcgct ggcattgacc ctgagtgatt
     tttctctggt cccgccgcat ccataccgcc agttgtttac cctcacaacg ttccagtaac
     cgggcatgtt catcatcagt aacccgtatc gtgagcatcc tctctcgttt catcggtatc
     attaccccca tgaacagaaa tcccccttac acggaggcat cagtgaccaa acaggaaaaa
     accgccctta acatggcccg ctttatcaga agccagacat taacgcttct ggagaaactc
     aacgagctgg acgcggatga acaggcagac atctgtgaat cgcttcacga ccacgctgat
     gagctttacc gcagctgcct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg
     cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt
     cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc
     gatagcggag tgtatactgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct
     cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
     cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
     acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
     ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
     ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
     gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
     gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
     ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
     actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
     gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
     ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
     ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
     gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
     tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
     tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
     aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
     aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
     tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
     gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
     agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
     aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctgcag
     gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
     caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
     cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
     ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
     ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac
     gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
     cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
     gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
     caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
     tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
     acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
     aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
     gtatcacgag gccctttcgt cttcaagaat tctcactcat taggcacccc aggctttaca
     ctttatgctt ccggctcgta taatgtgtgg aattgtgagc ggataacaat ttcacacagg
     aaacagaa
//