back Return to this vector's summary.
ID   PBRS242    preliminary; circular DNA; SYN; 4462 BP.
XX
AC   K02386; K02387;
XX
DT   01-AUG-1985 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pBRS242 - complete, 5' & 3' lacUV5 promoter.
XX
KW   cloning vector; drug resistance gene; mutational analysis;
KW   promoter region; operator; tetracycline resistance.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-43, 5'
RP   1-23, 3'
RC   pBRS206 from pBRS188 & pOP1, lambda immunity region
RC   pBRS242 from pBR322 & pBRS206
RC   pBRS240 from pBRS242
RC   pBRS246 from pBRS240
RC   pBRS2843, pBRS2852 from pBRS240
RC   pBRS2845, pBRS2846, pBRS2850 from pBRS240
RC   pBRS3077 from pBRS240
RC   pBRS2950 from pBRS240
RC   pBRS2849 from pBRS240
RC   pBRS2343 from pBRS188
RA   Savochkina L.P., Retchinsky V.O., Bibilashvili R.S.;
RT   "Stability of cloned promoter-containing fragments";
RL   Mol. Gen. Genet. 189:142-147(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   derived from insertion of lac UV5 promoter-operator region into
CC   pBR322.
CC   [1] inserted strong promoters from T7 and lambda into pBR322
CC   derived promoter-probe vectors. The inserted promoters, which
CC   occurred in dissimilar environments, served as promoters for the
CC   pBR322 tetracycline resistance operon.  Promoter strength was
CC   measured by Tc resistance.  Plasmids containing T7 A2 promoters
CC   appeared to confer less Tc resistance than those containing A3
CC   promoters.
CC   NCBI gi: 209320 & 209321
CC   NM (pBRS242)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(promoter analysis)
CC   SE ()
CC   PA (pBR322)(lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBRS188 EcoRI 4349bp, pBR322 4360..4360
FT                   2. E. coli EcoRI-EcoRI 99bp, lacUV5 promoter [104bp]
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> pBRS206 4448bp
FT                   1. pBR322 ClaI 4361bp 25..25
FT                   DNA polymerase I:DNA polymerase I
FT                   2. pBRS206 EcoRI-EcoRI 99bp, lacUV5 promoter [104bp]
FT                   DNA polymerase I:DNA polymerase I
FT                   -> pBRS242 4460bp"
FT   -               1..26
FT                   /note="pBR322 1..26 26bp
FT                   ClaI = AT^CG AT
FT                   \            aattct..."
FT   -               27..125
FT                   /note="99bp
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \ ...aacagaatt
FT                   ClaI =      AT^CGAT"
FT   -               126..4462
FT                   /note="pBR322 25..4361 4337bp"
FT   misc_recomb     38..39
FT                   /note="pBR322 DNA end/EcoRI linker start; 5'"
FT   misc_recomb     5..6
FT                   /note="EcoRI linker end/pBR322 DNA start; 3'"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7 A2 or A3 promoter"
FT   promoter        0..0
FT                   /note="PRO bacteriophage lambda"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
XX
SQ   Sequence 4462 BP; 1011 A; 1234 C; 1155 G; 1062 T; 0 other;
     ttctcatgtt tgacagctta tcatcgaatt ctcactcatt aggcacccca ggctttacac
     tttatgcttc cggctcgtat aatgtgtgga attgtgagcg gataacaatt tcacacagga
     aacagcgata agctttaatg cggtagttta tcacagttaa attgctaacg cagtcaggca
     ccgtgtatga aatctaacaa tgcgctcatc gtcatcctcg gcaccgtcac cctggatgct
     gtaggcatag gcttggttat gccggtactg ccgggcctct tgcgggatat cgtccattcc
     gacagcatcg ccagtcacta tggcgtgctg ctagcgctat atgcgttgat gcaatttcta
     tgcgcacccg ttctcggagc actgtccgac cgctttggcc gccgcccagt cctgctcgct
     tcgctacttg gagccactat cgactacgcg atcatggcga ccacacccgt cctgtggatc
     ctctacgccg gacgcatcgt ggccggcatc accggcgcca caggtgcggt tgctggcgcc
     tatatcgccg acatcaccga tggggaagat cgggctcgcc acttcgggct catgagcgct
     tgtttcggcg tgggtatggt ggcaggcccc gtggccgggg gactgttggg cgccatctcc
     ttgcatgcac cattccttgc ggcggcggtg ctcaacggcc tcaacctact actgggctgc
     ttcctaatgc aggagtcgca taagggagag cgtcgaccga tgcccttgag agccttcaac
     ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact tatgactgtc
     ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat tttcggcgag
     gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt cggaatcttg
     cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg cgagaagcag
     gccattatcg ccggcatggc ggccgacgcg ctgggctacg tcttgctggc gttcgcgacg
     cgaggctgga tggccttccc cattatgatt cttctcgctt ccggcggcat cgggatgccc
     gcgttgcagg ccatgctgtc caggcaggta gatgacgacc atcagggaca gcttcaagga
     tcgctcgcgg ctcttaccag cctaacttcg atcactggac cgctgatcgt cacggcgatt
     tatgccgcct cggcgagcac atggaacggg ttggcatgga ttgtaggcgc cgccctatac
     cttgtctgcc tccccgcgtt gcgtcgcggt gcatggagcc gggccacctc gacctgaatg
     gaagccggcg gcacctcgct aacggattca ccactccaag aattggagcc aatcaattct
     tgcggagaac tgtgaatgcg caaaccaacc cttggcagaa catatccatc gcgtccgcca
     tctccagcag ccgcacgcgg cgcatctcgg gcagcgttgg gtcctggcca cgggtgcgca
     tgatcgtgct cctgtcgttg aggacccggc taggctggcg gggttgcctt actggttagc
     agaatgaatc accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga
     cctgagcaac aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga
     agtcagcgcc ctgcaccatt atgttccgga tctgcatcgc aggatgctgc tggctaccct
     gtggaacacc tacatctgta ttaacgaagc gctggcattg accctgagtg atttttctct
     ggtcccgccg catccatacc gccagttgtt taccctcaca acgttccagt aaccgggcat
     gttcatcatc agtaacccgt atcgtgagca tcctctctcg tttcatcggt atcattaccc
     ccatgaacag aaatccccct tacacggagg catcagtgac caaacaggaa aaaaccgccc
     ttaacatggc ccgctttatc agaagccaga cattaacgct tctggagaaa ctcaacgagc
     tggacgcgga tgaacaggca gacatctgtg aatcgcttca cgaccacgct gatgagcttt
     accgcagctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc
     cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg
     cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg
     gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat
     gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc
     ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
     ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
     agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
     taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
     cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
     tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
     gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
     gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
     tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
     gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
     cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
     aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
     tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
     ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
     attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
     ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt
     ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa
     taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt
     tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac
     gaggcccttt cgtcttcaag aa
//