back Return to this vector's summary.
ID   PBSSKM     preliminary; circular DNA; SYN; 2964 BP.
AC   L08786; VB0079;
DT   04-JUN-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli phagemid vector BlueScribe SK- - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-2964
RC   BlueScribe SK-
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
RN   [2]
RC   pJF3 from pUC19 & T7 oligo
RC   pBS or BlueScribe from pJF3 & T3 oligo
RC   pBS+, pBS- from pBS or BlueScribe & pEMBL8
RC   pBluescript KS(+) from pBS+ & linker
RC   pBluescript KS(-) from pBS- & linker
RC   pBST-B from pBS & pEMBL8
RC   pBSITO#12 from pBST-B & pEMBL8
RC   pPreB from pBSITO#12 & pBluescript SK(-)
RC   lambda cI857 Sam7, lambda cI857 Sam100 nin5 from lambda
RC   lambda LongC from lambda cI857 Sam7 & pUC19 & lambda cI857 Sam100 nin5
RC   lambda LongD from lambda LongC
RC   lambda ZAP from lambda L47.1 & pPreB & lambda LongD
RA   Short J.M., Fernandez J.M., Sorge J.A., Huse W.D.;
RT   "Lambda ZAP: a bacteriophage lambda expression vector with in vivo
RT   excision properties";
RL   Nucleic Acids Res. 16:7583-7600(1988).
CC   These data and their annotation were supplied to GenBank by Will
CC   Gilbert under the auspices of the GenBank Currator Program.
CC   Sequence correction according to Stratagene.
CC   The stand shown corresponds to pUC19c.
CC   As in the published sequence of pUC19c, The M13mp19 lacZ region
CC   is on the complementary strand.
CC   This vector contains the f1 origin so that the minus strand
CC   can be obtained upon f1 superinfection.
CC   NM (BlueScribe SK-)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE (color)
CC   PA (BlueScribe M13-)(pUC19)(PromT7)(PromT3)(bGalKS)(PF1)
CC   BR (BlueScribe KS-)(BlueScribe SK-)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBS- remove EcoRI-HindIII 51bp 882..933,
FT                   \ MCS/3153bp
FT                   Klenow:Klenow
FT                   linker SacI-KpnI 275bp
FT                   \ ggaaacagctatgaccatgattacgccaagctcgaaatta
FT                   \ accctcactaaagggaacaaaagctggagctccaccgcggtggcggccgc
FT                   \ tctagaactagtggatcccccgggctgcaggaattcgatatcaagcttat
FT                   \ cgataccgtcgacctcgaggggggcccggtacccaattcgccctatagtg
FT                   \ agtcgtattacaattcactggccgtcgttttacaa
FT                   -> Bluescribe SK- 2964bp"
FT   misc_feature    3..458
FT                   /note="from bacteriophage f1"
FT   misc_feature    complement(460..624)
FT                   /note="from pUC19"
FT   promoter        626..645
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    complement(653..760)
FT                   /note="MCS
FT                   SacI-SacII-BstXI-XmaIII-NotI-XbaI-SpeI-BamHI-SmaI-
FT                   PstI-EcoRI-EcoRV-HindIII-ClaI-SalI-XhoI-ApaI-DraII-
FT                   KpnI; BlueScribe KS- polylinker"
FT   promoter        complement(772..791)
FT                   /note="PRO bacteriophage T3"
FT   misc_feature    complement(795..1031)
FT                   /note="from pUC19"
FT   misc_feature    complement(1032..2964)
FT                   /note="from pUC19"
FT   misc_feature    643..643
FT                   /note="start of T7 RNA synthesis"
FT   misc_feature    complement(774..774)
FT                   /note="start of T3 RNA synthesis"
FT   CDS             complement(1976..2764)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
SQ   Sequence 2964 BP; 707 A; 757 C; 734 G; 766 T; 0 other;
     ggacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac
     cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc
     cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt
     tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg
     gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag
     tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt
     ataagggatt ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt
     taacgcgaat tttaacaaaa tattaacgtt tacaatttcg cgccattcgc cattcaggct
     gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa
     agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg
     ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccgg
     gccccccctc gaggtcgacg gtatcgataa gcttgatatc gaattcctgc agcccggggg
     atccactagt tctagagcgg ccgccaccgc ggtggagctc cagcttttgt tccctttagt
     gagggttaat tccgagcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt
     atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
     cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg
     gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
     gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     catttccccg aaaagtgcca cctg