back Return to this vector's summary.
ID   PCHA       preliminary; circular DNA; SYN; 5508 BP.
XX
AC   IG5069;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCHA - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pNHA from pRc/CMV & oligo
RC   pCHA from pRc/CMV & oligo
RC   pNHRP33 from pNHA & oligo
RA   Pati U.K.;
RT   "Novel vectors for expression of cDNA encoding epitope-tagged
RT   proteins in mammalian cells";
RL   Gene 114:285-288(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pCHA)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pRc/CMV)(pNHRP33 from pBluescript)
CC   BR (pNHA)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pRc/CMV remove HindIII-ApaI 104bp 891..995,
FT                   \ MCS/5438bp
FT                   2. oligo HindIII-ApaI 70bp
FT                   \ agcttatgtctagagctagcatcgatgttaactacccatacgatgttcca
FT                   \ gattacgcttgatgagggcc
FT                   -> pCHA 5412bp"
FT   -               1..890
FT                   /note="pRc/CMV 1..890 890bp
FT                   HindIII = A^AGCTT
FT                   \           agctt..."
FT   -               891..960
FT                   /note="70bp
FT                   \ agcttatgtctagagctagcatcgatgttaactacccatacgatgttcca
FT                   \ gattacgcttgatgagggcc
FT                   \  ...agggcc
FT                   ApaI = GGGCC^C"
FT   -               961..5508
FT                   /note="pRc/CMV 995..5542 4548bp"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT NruI"
FT   promoter        0..0
FT                   /note="PRO human cytomegalovirus (CMV)
FT                   immediate early gene"
FT   misc_binding    0..0
FT                   /note="SIT NdeI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-XbaI-NheI-ClaI-HpaI-ApaI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   polyA_signal    0..0
FT                   /note="PLA E. coli BGH gene"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage M13"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase II gene
FT                   (NPTII), neomycin resistance gene (neo)"
FT   misc_binding    0..0
FT                   /note="SIT TthIIII"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   misc_binding    0..0
FT                   /note="SIT BsmI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
XX
SQ   Sequence 5508 BP; 1276 A; 1419 C; 1399 G; 1414 T; 0 other;
     gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg
     ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
     cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
     ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
     gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
     tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
     cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
     attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt
     atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
     atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
     tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
     actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
     aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
     gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
     ctgcttaact ggcttatcga aattaatacg actcactata gggagaccca agcttatgtc
     tagagctagc atcgatgtta actacccata cgatgttcca gattacgctt gatgagggcc
     ctattctata gtgtcaccta aatgctagag ctcgctgatc agcctcgact gtgccttcta
     gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca
     ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc
     attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata
     gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga accagctggg
     gctcgagggg ggatccccac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg
     ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct
     tcccttcctt tctcgccacg ttcgccggct ttccccgtca agctctaaat cggggcatcc
     ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt gattagggtg
     atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt
     ccacgttctt taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg
     tctattcttt tgatttataa gggattttgg ggatttcggc ctattggtta aaaaatgagc
     tgatttaaca aaaatttaac gcgaatttta acaaaatatt aacgtttaca atttaaatat
     ttgcttatac aatcttcctg tttttggggc ttttctgatt atcaaccggg gtgggtaccg
     agctcgaatt ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagg
     caggcagaag tatgcaaagc atgcatctca attagtcagc aaccaggtgt ggaaagtccc
     caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag
     tcccgcccct aactccgccc atcccgcccc taactccgcc cagttccgcc cattctccgc
     cccatggctg actaattttt tttatttatg cagaggccga ggccgcctcg gcctctgagc
     tattccagaa gtagtgagga ggcttttttg gaggcctagg cttttgcaaa aagctcccgg
     gagcttggat atccattttc ggatctgatc aagagacagg atgaggatcg tttcgcatga
     ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct
     atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc
     aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg
     acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg
     acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc
     tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc
     ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg
     agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc
     atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg
     aggatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc
     gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag
     cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg
     tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg
     agttcttctg agcgggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc
     atcacgagat ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt
     ccgggacgcc ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca
     ccccaacttg tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt
     cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt
     atcttatcat gtctggatcc cgtcgacctc gagagcttgg cgtaatcatg gtcatagctg
     tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata
     aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca
     ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc
     gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg
     cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta
     tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc
     aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag
     catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac
     caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc
     ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg ctcacgctgt
     aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc
     gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga
     cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta
     ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta
     tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga
     tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg
     cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag
     tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc
     tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact
     tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt
     cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta
     ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta
     tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc
     gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat
     agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt
     atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg
     tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca
     gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta
     agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg
     cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact
     ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg
     ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt
     actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga
     ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc
     atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa
     caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtc
//