back Return to this vector's summary.
ID   PCV1       preliminary; circular DNA; SYN; 4394 BP.
XX
AC   IG9875;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCV1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCV1 from pBR322 & linker
RC   pSKS101 from pUC7 & Tn5
RC   pSKS114 from pUC7 & Tn9
RC   pMC1827, pMC1828 from pMC1403 & pSKS101
RC   pMC1843 from pMC1827
RC   pMLB1034 from pMC1403
RC   pMC1844 from pMLB1034 & pUC7
RC   pSKS104 from pMC1403 & pUC7
RC   pSKS105 from pMC1403 & pUC8
RC   pSKS106 from pMC1403 & pUC9
RC   pSKS107 from pSKS105
RC   pFR10 from pSKS106 & pCV1
RC   pFR97 from pSKS104 & pFR10
RC   pFR98 from pSKS105 & pFR10
RC   pFR109 from pSKS106 & pFR10
RC   plasmid from pMC279 & pMC1403
RC   plasmid2 from plasmid & pSKS101
RC   pMC1871 from plasmid2 & pMC1843
RA   Shapira S.K., Chou J., Richaud F.V., Casadaban M.J.;
RT   "New versatile plasmid vectors for expression of hybrid proteins
RT   coded by a cloned gene fused to lacZ gene sequences encoding an
RT   enzymatically active carboxy-terminal portion of beta-galactosidase";
RL   Gene 25:71-82(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pCV1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 ClaI 4361bp 25..25, tet gene
FT                   2. SacI-XhoI-XbaI-ClaI-HindIII linker 31bp
FT                   \ atcggagctcgagtctagaatcgataagctt
FT                   -> pCV1 4392bp"
FT   -               1..26
FT                   /note="pBR322 1..26 26bp
FT                   ClaI = AT^CG AT
FT                   \            atcggag..."
FT   -               27..57
FT                   /note="atcggagctcgagtctagaatcgataagctt 31bp
FT                   \ ...aagctt
FT                   ClaI =   AT^CGAT"
FT   -               58..4394
FT                   /note="pBR322 25..4361 4337bp"
FT   misc_binding    0..0
FT                   /note="MCS SacI-XhoI-XbaI-ClaI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4394 BP; 992 A; 1217 C; 1143 G; 1042 T; 0 other;
     ttctcatgtt tgacagctta tcatcgatcg gagctcgagt ctagaatcga taagcttcga
     taagctttaa tgcggtagtt tatcacagtt aaattgctaa cgcagtcagg caccgtgtat
     gaaatctaac aatgcgctca tcgtcatcct cggcaccgtc accctggatg ctgtaggcat
     aggcttggtt atgccggtac tgccgggcct cttgcgggat atcgtccatt ccgacagcat
     cgccagtcac tatggcgtgc tgctagcgct atatgcgttg atgcaatttc tatgcgcacc
     cgttctcgga gcactgtccg accgctttgg ccgccgccca gtcctgctcg cttcgctact
     tggagccact atcgactacg cgatcatggc gaccacaccc gtcctgtgga tcctctacgc
     cggacgcatc gtggccggca tcaccggcgc cacaggtgcg gttgctggcg cctatatcgc
     cgacatcacc gatggggaag atcgggctcg ccacttcggg ctcatgagcg cttgtttcgg
     cgtgggtatg gtggcaggcc ccgtggccgg gggactgttg ggcgccatct ccttgcatgc
     accattcctt gcggcggcgg tgctcaacgg cctcaaccta ctactgggct gcttcctaat
     gcaggagtcg cataagggag agcgtcgacc gatgcccttg agagccttca acccagtcag
     ctccttccgg tgggcgcggg gcatgactat cgtcgccgca cttatgactg tcttctttat
     catgcaactc gtaggacagg tgccggcagc gctctgggtc attttcggcg aggaccgctt
     tcgctggagc gcgacgatga tcggcctgtc gcttgcggta ttcggaatct tgcacgccct
     cgctcaagcc ttcgtcactg gtcccgccac caaacgtttc ggcgagaagc aggccattat
     cgccggcatg gcggccgacg cgctgggcta cgtcttgctg gcgttcgcga cgcgaggctg
     gatggccttc cccattatga ttcttctcgc ttccggcggc atcgggatgc ccgcgttgca
     ggccatgctg tccaggcagg tagatgacga ccatcaggga cagcttcaag gatcgctcgc
     ggctcttacc agcctaactt cgatcactgg accgctgatc gtcacggcga tttatgccgc
     ctcggcgagc acatggaacg ggttggcatg gattgtaggc gccgccctat accttgtctg
     cctccccgcg ttgcgtcgcg gtgcatggag ccgggccacc tcgacctgaa tggaagccgg
     cggcacctcg ctaacggatt caccactcca agaattggag ccaatcaatt cttgcggaga
     actgtgaatg cgcaaaccaa cccttggcag aacatatcca tcgcgtccgc catctccagc
     agccgcacgc ggcgcatctc gggcagcgtt gggtcctggc cacgggtgcg catgatcgtg
     ctcctgtcgt tgaggacccg gctaggctgg cggggttgcc ttactggtta gcagaatgaa
     tcaccgatac gcgagcgaac gtgaagcgac tgctgctgca aaacgtctgc gacctgagca
     acaacatgaa tggtcttcgg tttccgtgtt tcgtaaagtc tggaaacgcg gaagtcagcg
     ccctgcacca ttatgttccg gatctgcatc gcaggatgct gctggctacc ctgtggaaca
     cctacatctg tattaacgaa gcgctggcat tgaccctgag tgatttttct ctggtcccgc
     cgcatccata ccgccagttg tttaccctca caacgttcca gtaaccgggc atgttcatca
     tcagtaaccc gtatcgtgag catcctctct cgtttcatcg gtatcattac ccccatgaac
     agaaatcccc cttacacgga ggcatcagtg accaaacagg aaaaaaccgc ccttaacatg
     gcccgcttta tcagaagcca gacattaacg cttctggaga aactcaacga gctggacgcg
     gatgaacagg cagacatctg tgaatcgctt cacgaccacg ctgatgagct ttaccgcagc
     tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg
     gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg
     ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac gtagcgatag cggagtgtat
     actggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat atgcggtgtg
     aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc
     tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
     cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
     gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
     gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
     gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
     ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
     atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
     tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
     ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
     gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
     ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
     ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
     agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
     ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa
     aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta
     tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
     cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
     tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac
     cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
     ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta
     gttcgccagt taatagtttg cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac
     gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
     gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
     gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
     tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
     aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aacacgggat aataccgcgc
     cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
     caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
     cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
     ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
     aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
     tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg
     tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct
     ttcgtcttca agaa
//