back Return to this vector's summary.
ID   PDPL13     preliminary; circular DNA; SYN; 3252 BP.
XX
AC   K00611;
XX
DT   05-APR-1984 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pDPL13 - complete, polylinker region.
XX
KW   cloning vector; artificial gene.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-79
RC   pANS or pUH24, pANL or pUH25 from A.nidulans DNA
RC   pDPL13 from pBR322 & linker
RC   pECAN1 from pANS & pBR325
RC   pPLAN B2 from pANS & pDPL13
RC   pCB4 from pPLAN B2
RC   plasmid from pDPL13 & pC194
RA   Gendel S., Straus N., Pulleyblank D., Williams J.;
RT   "Shuttle cloning vectors for the cyanobacterium anacystis nidulans";
RL   J. Bacteriol. 156:148-154(1983).
XX
RN   [2]
RC   pBR322::Cm from pBR322 & E.coli cat gene
RC   pLS101, pLS102, pLS104, pLS105, pLS106 from pUH24 & pBR322::Cm
RC   pLS103 from pUH24 & pBR322::Cm
RA   Sherman L., Van De Putte P.;
RT   "Construction of a hybrid plasmid capable of replication in the
RT   bacterium Escherichia coli and the cyanobacterium Anacystis nidulans";
RL   J. Bacteriol. 150:410-413(1982).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   [1] combined this plasmid with the small endogenous plasmid of
CC   A.nidulans to create a hybrid plasmid. the sequence presented here
CC   is the polylinker region which has been inserted in place of the
CC   tetracycline resistance gene.
CC   NCBI gi: 208702
CC   NM (pDPL13)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(A.nidulans small endogenous plasmid)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove ClaI-NarI 1182bp 25..1207,
FT                   \ tet/3179bp
FT                   2. linker ClaI-HindIII-XbaI-SmaI-BamHI-SalI-KpnI-NruI-
FT                   SacI-EcoRI-XhoI-StuI-XhoI-NarI 79bp
FT                   \ atcgataagcttctagagatcccgggatccgtcgacggtaccgatcgcga
FT                   \ gctcgaattcctcgaggcctcgaggcgcc
FT                   -> pDPL13 3258bp"
FT   -               1..24
FT                   /note="pBR322 1..24 24bp
FT                   ClaI = AT^CGAT
FT                   \         cgat..."
FT   -               25..97
FT                   /note="73bp
FT                   \ cgataagcttctagagatcccgggatccgtcgacggtaccgatcgcga
FT                   \ gctcgaattcctcgaggcctcgagg
FT                   \ ...tcgagg
FT                   NarI =   GG^CGCC"
FT   -               98..3252
FT                   /note="pBR322 1207..4361 3155bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_binding    0..0
FT                   /note="MCS ClaI-HindIII-XbaI-SmaI-BamHI-SalI-KpnI-
FT                   NruI-SacI-EcoRI-XhoI-StuI-XhoI-NarI"
XX
SQ   Sequence 3252 BP; 798 A; 869 C; 809 G; 776 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gcttctagag atcccgggat ccgtcgacgg
     taccgatcgc gagctcgaat tcctcgaggc ctcgaggcgc cgccctatac cttgtctgcc
     tccccgcgtt gcgtcgcggt gcatggagcc gggccacctc gacctgaatg gaagccggcg
     gcacctcgct aacggattca ccactccaag aattggagcc aatcaattct tgcggagaac
     tgtgaatgcg caaaccaacc cttggcagaa catatccatc gcgtccgcca tctccagcag
     ccgcacgcgg cgcatctcgg gcagcgttgg gtcctggcca cgggtgcgca tgatcgtgct
     cctgtcgttg aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc
     accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac
     aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc
     ctgcaccatt atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc
     tacatctgta ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg
     catccatacc gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc
     agtaacccgt atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag
     aaatccccct tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc
     ccgctttatc agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga
     tgaacaggca gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg
     cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt
     cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg
     tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac
     tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa
     ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc
     actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg
     gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc
     cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
     ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga
     ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc
     ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat
     agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg
     cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
     aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga
     gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact
     agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
     ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag
     cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
     tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa
     aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata
     tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg
     atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata
     cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg
     gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct
     gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt
     tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc
     tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga
     tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt
     aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc
     atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa
     tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca
     catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca
     aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct
     tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc
     gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa
     tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt
     tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc
     taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt
     cgtcttcaag aa
//