back Return to this vector's summary.
ID   PDR540     preliminary; circular DNA; SYN; 4063 BP.
XX
AC   IG0038; ATCC37282;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pDR540 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pDR206 from lacUV5 promoter
RC   [pDR540 from lacUV5 promoter]
RC   [pDR720 from lacUV5 promoter]
RC   from pKO series, gal gene/tac promoter
RA   Russell D.R., Bennett G.N.;
RT   "Construction and analysis of in vivo activity of E. coli promoter
RT   hybrids and promoter mutants that alter the -35 to -10 spacing";
RL   Gene 20:231-243(1982).
XX
RN   [2]
RC   this-phage from M13mp7 & pUC9HStop
RC   KR54 from this-phage & pDR540
RC   KR72 from KR54
RA   Thogersen H.C., Morris H.R., Rand K.N., Gait M.J.;
RT   "Location of the adenylation site in T4 RNA ligase";
RL   Eur. J. Biochem. 147:325-329(1985).
XX
RN   [3]
RC   pDR42 from pBR322 & pDR12, trp promoter
RA   Herrin G.R., Russell D.R., Bennett G.N.;
RT   "A stable derivative ofpBR322 conferring increased tetracyclin
RT   resistance and increased sensitivity to fusaric acid";
RL   Plasmid 7:290-293(1982).
XX
RN   [4]
RC   pDR12 from trp promoter
RA   Russell D.R., Bennett G.N.;
RT   "Cloning of small DNA fragments containing the Escherichia coli
RT   tryptophan operon promoter and operator";
RL   Gene 17:9-18(1982).
XX
CC   tac promoter can be removed by a HindIII and BamHI digest.
CC   This plasmid is unstable when transformed into C600 galK-.
CC   Contains an easily purifiable trp-lac hybrid promoter which can be
CC   used to construct expression vectors.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pDR540)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Pharmacia)(ATCC)
CC   HO (E.coli JM103)(E.coli JM105)(E.coli)
CC   CP ()
CC   FN (expression)(transcription)
CC   SE ()
CC   PA (pKO-1)(pBR322)(galK)
CC   BR (pDR720)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. E. coli EcoRI-AluI 99bp, lacUV5 promoter
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   2. E. coli 279bp, trp
FT                   3. pKO-1 EcoRI-HindIII 3685bp 294..3979
FT                   -> pDR540 4063bp"
FT   misc_binding    1..1
FT                   /note="SIT unique HindIII"
FT   promoter        2..97
FT                   /note="PRO E. coli tac (trp -35 and lacUV5 -10)"
FT   RBS             85..85
FT                   /note="RBS E. coli lac gene"
FT   RBS             92..92
FT                   /note="RBS E. coli lac gene"
FT   misc_binding    97..97
FT                   /note="SIT unique BamHI"
FT   CDS             282..1430
FT                   /note="GEN E. coli galactokinase gene (galK+)"
FT   rep_origin      1937..1937
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(2703..3563)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    3769..3769
FT                   /note="SIT unique EcoRI"
FT   misc_feature    3769..4063
FT                   /note="pKO-1 EcoRI-HindIII fragment"
XX
SQ   Sequence 4063 BP; 1019 A; 1048 C; 1044 G; 952 T; 0 other;
     aagcttactc cccatccccc tgttgacaat taatcatcgg ctcgtataat gtgtggaatt
     gtgagcggat aacaatttca cacaggaaac aggatcctct acgccgataa gctctgcacg
     cgcactttta tccgcctctg ctgcgctccg ccaccgtacg taaatttatg gttggttatg
     aaatgctggc agagacccag cgagacctga ccgcagaaca ggcagcagag cgtttgcgcg
     cagtcagcga tatccatttt cgcgaatccg gagtgtaaga aatgagtctg aaagaaaaaa
     cacaatctct gtttgccaac gcatttggct accctgccac tcacaccatt caggcgcctg
     gccgcgtgaa tttgattggt gaacacaccg actacaacga cggtttcgtt ctgccctgcg
     cgattgatta tcaaaccgtg atcagttgtg caccacgcga tgaccgtaaa gttcgcgtga
     tggcagccga ttatgaaaat cagctcgacg agttttccct cgatgcgccc attgtcgcac
     atgaaaacta tcaatgggct aactacgttc gtggcgtggt gaaacatctg caactgcgta
     acaacagctt cggcggcgtg gacatggtga tcagcggcaa tgtgccgcag ggtgccgggt
     taagttcttc cgcttcactg gaagtcgcgg tcggaaccgt attgcagcag ctttatcatc
     tgccgctgga cggcgcacaa atcgcgctta acggtcagga agcagaaaac cagtttgtag
     gctgtaactg cgggatcatg gatcagctaa tttccgcgct cggcaagaaa gatcatgcct
     tgctgatcga ttgccgctca ctggggacca aagcagtttc catgcccaaa ggtgtggctg
     tcgtcatcat caacagtaac ttcaaacgta ccctggttgg cagcgaatac aacacccgtc
     gtgaacagtg cgaaaccggt gcgcgtttct tccagcagcc agccctgcgt gatgtcacca
     ttgaagagtt caacgctgtt gcgcatgaac tggacccgat cgtggcaaaa cgcgtgcgtc
     atatactgac tgaaaacgcc cgcaccgttg aagctgccag cgcgctggag caaggcgacc
     tgaaacgtat gggcgagttg atggcggagt ctcatgcctc tatgcgcgat gatttcgaaa
     tcaccgtgcc gcaaattgac actctggtag aaatcgtcaa agctgtgatt ggcgacaaag
     gtggcgtacg catgaccggc ggcggatttg gcggctgtat cgtcgcgctg atcccggaag
     agctggtgcc tgccgtacag caagctgtcg ctgaacaata tgaagcaaaa acaggtatta
     aagagacttt ttacgtttgt aaaccatcac aaggagcagg acagtgctga acgaaactcc
     cgcactggca cccgatggtc agccgtaccg actgttctgc ctcgcgcgtt tcggtgatga
     cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga
     tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc
     agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca
     gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg
     agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc
     gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa
     tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt
     aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa
     aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt
     ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
     tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc
     agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc
     gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta
     tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct
     acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
     tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa
     caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa
     aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa
     aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt
     ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac
     agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc
     atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
     cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata
     aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc
     cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
     aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca
     ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
     gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca
     ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt
     tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
     tgctcttgcc cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg
     ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga
     tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc
     agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg
     acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag
     ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
     gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg
     acattaacct ataaaaatag gcgtatcacg aggccctttc gtcttcaaga attctggcga
     atcctctgac cagccagaaa acgacctttc tgtggtgaaa ccggatgctg caattcagag
     cgccagcaag tgggggacag cagaagacct gaccgccgca gagtggatgt ttgacatggt
     gaagactatc gcaccatcag ccagaaaacc gaattttgct gggtgggcta acgatatccg
     cctgatgcgt gaacgtgacg gacgtaacca ccgcgacatg tgtgtgctgt tccgctgggc
     atgccaggac aacttctggt ccggtaacgt gctgagcccg gcc
//