back Return to this vector's summary.
ID   PECE       preliminary; circular DNA; SYN; 4577 BP.
XX
AC   IG9910;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pECE - complete, SV40 early promoter.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSV1 from pBR322 & SV40 early genes
RC   pAS from pSV1
RC   pEMP from pSV1 & SV40 T antigen
RC   HS0, HS1, HS2, HS3, HS4, HS6 from pSV1 & pEMP
RC   pHS102 from pBR322 & SV40
RA   Benoist C., Chambon P.;
RT   "Deletions covering the putative promoter region of early mRNAs of
RT   simian virus 40 do not abolish T-antigen expression";
RL   Proc. Natl. Acad. Sci. U.S.A. 77:3865-3869(1980).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pECE)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(SV40)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376
FT                   2. SV40 BamHI 5243bp 2534..2534
FT                   -> pSV40 9604bp
FT                   1. pSV40 HindIII 9604bp, SV40 5172..5172
FT                   Klenow
FT                   BclI 9608bp, SV40 2271..2271
FT                   2. linker BglII-SmaI-XbaI 26bp
FT                   \ agatctcccgggtctagataagtaat
FT                   -> pLSV40 (OL/PL) 9634bp
FT                   1. pLSV40 (OL/PL) remove KpnI-AatII 3987bp,
FT                   \ SV40 299..4286/pBR322 AatII 4291/5647bp
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> plasmid 6200bp
FT                   1. plasmid remove SalI-NdeI 1645bp, pBR322 652..2297
FT                   \ 4600bp
FT                   \ SV40 NdeI 3811 4829 no SalI
FT                   Klenow:Klenow
FT                   2. linker BglII-HindIII-SalI-KpnI-SmaI-EcoRI-SstI-XbaI
FT                   \ 39bp gatctaagcttgtcgacggtaccccggggaattcgagct
FT                   -> pECE 4600bp"
FT   -               1..1976
FT                   /note="SV40 295..2270 1976bp
FT                   BclI = T^GATCA
FT                   \        gatct..."
FT   -               1977..2001
FT                   /note="gatctcccgggtctagataagtaat 25bp
FT                   \ ...aagtaat
FT                   BclI =     T^GATCA"
FT   -               2002..2264
FT                   /note="SV40 2271..2533 263bp
FT                   BamHI = G^GATCC"
FT   -               2265..2544
FT                   /note="pBR322 376..655 280bp
FT                   SalI = G^TCGA C
FT                   \             gatcta..."
FT   -               2545..2583
FT                   /note="gatctaagcttgtcgacggtaccccggggaattcgagct 39bp
FT                   \ ...cgagct
FT                   NdeI =   CA^TATG"
FT   -               2584..4577
FT                   /note="pBR322 2297..4290 1994bp
FT                   AatII =      GACGT^C
FT                   KpnI = Asp718I = G GTAC^C"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4577 BP; 1208 A; 1035 C; 1126 G; 1208 T; 0 other;
     gtacctaacc aagttcctct ttcagaggtt atttcaggcc atggtgctgc gccggctgtc
     acgccaggcc tccgttaagg ttcgtaggtc atggactgaa agtaaaaaaa cagctcaacg
     cctttttgtg tttgttttag agcttttgct gcaattttgt gaaggggaag atactgttga
     cgggaaacgc aaaaaaccag aaaggttaac tgaaaaacca gaaagttaac tggtaagttt
     agtctttttg tcttttattt caggtccatg ggtgctgctt taacactgtt gggggaccta
     attgctactg tgtctgaagc tgctgctgct actggatttt cagtagctga aattgctgct
     ggagaggccg ctgctgcaat tgaagtgcaa cttgcatctg ttgctactgt tgaaggccta
     acaacctctg aggcaattgc tgctataggc ctcactccac aggcctatgc tgtgatatct
     ggggctcctg ctgctatagc tggatttgca gctttactgc aaactgtgac tggtgtgagc
     gctgttgctc aagtggggta tagatttttt agtgactggg atcacaaagt ttctactgtt
     ggtttatatc aacaaccagg aatggctgta gatttgtata ggccagatga ttactatgat
     attttatttc ctggagtaca aacctttgtt cacagtgttc agtatcttga ccccagacat
     tggggtccaa cactttttaa tgccatttct caagcttttt ggcgtgtaat acaaaatgac
     attcctaggc tcacctcaca ggagcttgaa agaagaaccc aaagatattt aagggacagt
     ttggcaaggt ttttagagga aactacttgg acagtaatta atgctcctgt taattggtat
     aactctttac aagattacta ctctactttg tctcccatta ggcctacaat ggtgagacaa
     gtagccaaca gggaagggtt gcaaatatca tttgggcaca cctatgataa tattgatgaa
     gcagacagta ttcagcaagt aactgagagg tgggaagctc aaagccaaag tcctaatgtg
     cagtcaggtg aatttattga aaaatttgag gctcctggtg gtgcaaatca aagaactgct
     cctcagtgga tgttgccttt acttctaggc ctgtacggaa gtgttacttc tgctctaaaa
     gcttatgaag atggccccaa caaaaagaaa aggaagttgt ccaggggcag ctcccaaaaa
     accaaaggaa ccagtgcaag tgccaaagct cgtcataaaa ggaggaatag aagttctagg
     agttaaaact ggagtagaca gcttcactga ggtggagtgc tttttaaatc ctcaaatggg
     caatcctgat gaacatcaaa aaggcttaag taaaagctta gcagctgaaa aacagtttac
     agatgactct ccagacaaag aacaactgcc ttgctacagt gtggctagaa ttcctttgcc
     taatttaaat gaggacttaa cctgtggaaa tattttgatg tgggaagctg ttactgttaa
     aactgaggtt attggggtaa ctgctatgtt aaacttgcat tcagggacac aaaaaactca
     tgaaaatggt gctggaaaac ccattcaagg gtcaaatttt catttttttg ctgttggtgg
     ggaacctttg gagctgcagg gtgtgttagc aaactacagg accaaatatc ctgctcaaac
     tgtaacccca aaaaatgcta cagttgacag tcagcagatg aacactgacc acaaggctgt
     tttggataag gataatgctt atccagtgga gtgctgggtt cctgatccaa gtaaaaatga
     aaacactaga tattttggaa cctacacagg tggggaaaat gtgcctcctg ttttgcacat
     tactaacaca gcaaccacag tgcttcttga tgagcagggt gttgggccct tgtgcagatc
     tcccgggtct agataagtaa taagctgaca gcttgtatgt ttctgctgtt gacatttgtg
     ggctgtttac caacacttct ggaacacagc agtggaaggg acttcccaga tattttaaaa
     ttacccttag aaagcggtct gtgaaaaacc cctacccaat ttcctttttg ttaagtgacc
     taattaacag gaggacacag agggtggatg ggcagcctat gattggaatg tcctctcaag
     tagaggaggt tagggtttat gaggacacag aggagcttcc tggggatcct ctacgccgga
     cgcatcgtgg ccggcatcac cggcgccaca ggtgcggttg ctggcgccta tatcgccgac
     atcaccgatg gggaagatcg ggctcgccac ttcgggctca tgagcgcttg tttcggcgtg
     ggtatggtgg caggccccgt ggccggggga ctgttgggcg ccatctcctt gcatgcacca
     ttccttgcgg cggcggtgct caacggcctc aacctactac tgggctgctt cctaatgcag
     gagtcgcata agggagagcg tcgagatcta agcttgtcga cggtaccccg gggaattcga
     gcttatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc
     ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc
     agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa
     catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt
     tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg
     gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg
     ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag
     cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc
     caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa
     ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg
     taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc
     taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac
     cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg
     tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt
     gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
     catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa
     atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga
     ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt
     gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg
     agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga
     gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga
     agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctgcagg
     catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc
     aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc
     gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca
     taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac
     caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaacacg
     ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc
     ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg
     tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac
     aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat
     actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata
     catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
     agtgccacct gacgtct
//