back Return to this vector's summary.
ID   PEMBL8P    preliminary; circular DNA; SYN; 3939 BP.
XX
AC   X04995; M19090; ATCC37396;
XX
DT   07-JUN-1987 (Rel. 2, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phasmid vector pEMBL8+ - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pEMBL8, pEMBL8+, pEMBL8- from pUC8 & pD4
RC   plasmid from pEMBL8
RC   lambda G7 from plasmid & lambda NM616
RC   lambda G43 from lambda G7 & pUC9
RC   pEMBL9, pEMBL9+, pEMBL9- from plasmid & lambda G43
RA   Dente L., Cesareni G., Cortese R.;
RT   "pEMBL: a new family of single stranded plasmids";
RL   Nucleic Acids Res. 11:1645-1654(1983).
XX
RN   [2]
RP   1-3939
RC   pEMBL8+
RA   Pfeiffer F.;
RT   ;
RL   Submitted (02-JUN-1987) on paper to the EMBL Data Library by:
RL   Pfeiffer F., MPI Biochemie, Martinsried, Germany.
XX
RN   [3]
RC   pEMBL8, pEMBL8+, pEMBL8- from pD4 & pUC8
RC   pEMBL9, pEMBL9+, pEMBL9- from pD4 & pUC9
RC   pEMBL18+ from pEMBL8+ & M13mp18
RC   pEMBL18- from pEMBL8- & M13mp18
RC   pEMBL19+ from pEMBL8+ & M13mp19
RC   pEMBL19- from pEMBL8- & M13mp19
RC   pEMBL130+ from pEMBL8+ & M13tg130
RC   pEMBL130- from pEMBL8- & M13tg130
RC   pEMBL131+ from pEMBL8+ & M13tg131
RC   pEMBL131- from pEMBL8- & M13tg131
RA   Dente L., Cortese R.;
RT   "pEMBL: a new family of single-stranded plasmids for sequencing DNA";
RL   Meth. Enzymol. 155:111-119(1987).
XX
CC   According to the cloning strategy, the phage f1 origin should
CC   be flanked by regenerated EcoRI sites, but these are not found
CC   experimentally.
CC   The given sequence must be incorrect around this position.
CC   The base n was introduced to destroy the EcoRI site (GAAnTTC).
CC   ssDNA-producing plasmid with polylinker in lacZ'.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pEMBL8+)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phasmid)
CC   SP (ATCC)
CC   HO (E.coli 71/18)(E.coli)(E.coli JM series)
CC   CP ()
CC   FN (transcription)
CC   SE ()
CC   PA (pUC8)(M13mp8)
CC   BR (pEMBL8-)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC8 NarI 2665bp 426..426, between amp & lac
FT                   2. pD4 EcoRI-? 1260bp 4292..5552, f1 ori
FT                   -> pEMBL8+ 3939bp"
FT   misc_feature    1..3939
FT                   /note="pEMBL8+ (plus) sequence"
FT   misc_feature    1..423
FT                   /note="from pUC8 (bases 1..423)"
FT   misc_feature    228..263
FT                   /note="MCS EcoRI-SmaI-NciI-BamHI-SalI-HincII-BspI-
FT                   PstI-HindIII,
FT                   from M13mp8/pUC8-polylinker (bases 1..36)"
FT   misc_feature    0..0
FT                   /note="ATG to lacZ
FT                   ctatgaccatgattacgaattcccggggatccgtcgacctgcagccaagct
FT                   tggcactgg"
FT   misc_feature    423..429
FT                   /note="destroyed EcoRI site (GAAnTTC) (bases 1..7)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1 intergenic region"
FT   misc_feature    430..1692
FT                   /note="from bacteriophage f1,
FT                   bases complement(5147..6407)"
FT   misc_feature    1375..1378
FT                   /note="AGAG in pEMBL8+; AG in bacteriophage f1"
FT   misc_feature    1694..1700
FT                   /note="destroyed EcoRI site (GAAnTTC) (bases 1..7)"
FT   misc_feature    1700..3939
FT                   /note="from pUC8 (bases 426..2665)"
FT   misc_feature    2205..2993
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp) (bases 1..789)"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ')"
FT   misc_binding    0..0
FT                   /note="SIT ClaI"
FT   misc_binding    0..0
FT                   /note="SIT EcoB"
FT   misc_binding    0..0
FT                   /note="SIT NaeI"
XX
SQ   Sequence 3939 BP; 955 A; 968 C; 929 G; 1085 T; 2 other;
     gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg
     acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca
     ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg
     tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgaa ttcccgggga
     tccgtcgacc tgcagccaag cttggcactg gccgtcgttt tacaacgtcg tgactgggaa
     aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt
     aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa
     tggaanttcc agacgattga gcgtcaaaat gtaggtattt ccatgagcgt ttttcctgtt
     gcaatggctg gcggtaatat tgttctggat attaccagca aggccgatag tttgagttct
     tctactcagg caagtgatgt tattactaat caaagaagta ttgcgacaac ggttaatttg
     cgtgatggac agactctttt actcggtggc ctcactgatt ataaaaacac ttctcaggat
     tctggcgtac cgttcctgtc taaaatccct ttaatcggcc tcctgtttag ctcccgctct
     gattctaacg aggaaagcac gttatacgtg ctcgtcaaag caaccatagt acgcgccctg
     tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc
     cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg
     ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg
     gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc catcgccctg
     atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt
     ccaaactgga acaacactca accctatctc ggtctattct tttgatttat aagggatttt
     gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt
     taacaaaata ttaacgttta caatttaaat atttgcttat acaatcttcc tgtttttggg
     gcttttctga ttatcaaccg gggtacatat gattgacatg ctagttttac gattaccgtt
     catcgattct cttgtttgct ccagactctc aggcaatgac ctgatagcct ttgtagagac
     ctctcaaaaa tagctaccct ctccggcatg aatttatcag ctagaacggt tgaatatcat
     attgatggtg atttgactgt ctccggcctt tctcacccgt ttgaatcttt acctacacat
     tactcaggca ttgcatttaa aatatatgag ggttctaaaa atttttatcc ttgcgttgaa
     ataaaggctt ctcccgcaaa agtattacag ggtcataatg tttttggtac aaccgattta
     gctttatgct ctgaggcttt attgcttaat tttgctaatt ctttgccttg cctgtatgat
     ttattggatg ttggaanttc ctgatgcggt attttctcct tacgcatctg tgcggtattt
     cacaccgcat atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc
     cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg
     cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat
     caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca
     tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc
     ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct
     gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg
     cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg
     tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc
     tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca
     cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac
     tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa
     agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg
     ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt
     ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg
     aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc
     gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga
     tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta
     ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc
     cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg
     atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt
     cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa
     ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt
     cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt
     ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt
     tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga
     taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag
     caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata
     agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg
     gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga
     gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca
     ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa
     acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt
     tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac
     ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt
     ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga
     ccgagcgcag cgagtcagtg agcgaggaag cggaagagc
//