back Return to this vector's summary.
ID   PES1       preliminary; circular DNA; SYN; 2718 BP.
XX
AC   IG9816;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pES1 - complete, oligonucleotide transcript.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-99
RC   pES1 from pUC18 & oligo
RC   pES2 from pES1 & oligo
RC   pB5, pG1, pO2, pR4 from pES2
RA   Ebe K., Schold M., Rossi J.J., Wallace R.B.;
RT   "Enzymatic synthesis of oligoribonucleotides of defined sequence";
RL   DNA 6:497-504(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pES1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(oligonucleotide transcription)
CC   SE ()
CC   PA (pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 EcoRI 2686bp 451..451, in lacZ gene
FT                   blunt end:blunt end
FT                   2. oligo 36bp aattacttgacaattagttaactatttgttataatg
FT                   -> pES1 2722bp [no lacZ expression]"
FT   -               1..450
FT                   /note="pUC18 1..450 450bp
FT                   EcoRI = G^AATTC
FT                   \         aatta..."
FT   -               451..486
FT                   /note="aattacttgacaattagttaactatttgttataatg 36bp
FT                   \    ...ataatg
FT                   EcoRI = G^AATT C"
FT   -               487..2718
FT                   /note="pUC18 455..2686 2232bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2718 BP; 679 A; 680 C; 687 G; 672 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg
     actctagagg atccccgggt accgagctcg aattacttga caattagtta actatttgtt
     ataatgcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
     cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct
     aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
     agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt
     ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
     ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca
     tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     tggcgctttc tcaaagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact
     atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta
     acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta
     actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct
     tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt
     tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga
     tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca
     tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat
     caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg
     cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
     agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag
     acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc
     gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag
     ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
     tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa
     ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga
     tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata
     attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca
     agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg
     ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg
     ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg
     cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag
     gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac
     tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca
     tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag
     tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa aataggcgta
     tcacgaggcc ctttcgtc
//