back Return to this vector's summary.
ID   PES2       preliminary; circular DNA; SYN; 2781 BP.
XX
AC   M18183;
XX
DT   15-MAR-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pES2 - complete, oligonucleotide transcript.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-99
RC   pES1 from pUC18 & oligo
RC   pES2 from pES1 & oligo
RC   pB5, pG1, pO2, pR4 from pES2
RA   Ebe K., Schold M., Rossi J.J., Wallace R.B.;
RT   "Enzymatic synthesis of oligoribonucleotides of defined sequence";
RL   DNA 6:497-504(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 208986
CC   NM (pES2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(oligonucleotide transcription)
CC   SE ()
CC   PA (pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 EcoRI 2686bp 451..451, in lacZ gene
FT                   blunt end:blunt end
FT                   2. oligo 36bp aattacttgacaattagttaactatttgttataatg
FT                   -> pES1 2722bp [no lacZ expression]
FT                   1. pES1 EcoRI 2722bp 451..451
FT                   blunt end:blunt end
FT                   2. oligo 63bp aattcataattgtgagcggataacaatttcacacag
FT                   \ gaaacaaaatccatggccatgattact
FT                   -> pES2 2785bp [lacZ expression]"
FT   -               1..450
FT                   /note="pUC18 1..450 450bp
FT                   EcoRI = G^AATTC
FT                   \         aatta..."
FT   -               451..486
FT                   /note="aattacttgacaattagttaactatttgttataatg 36bp
FT                   EcoRI = G^AATTC"
FT   -               487..549
FT                   /note="63bp
FT                   \ aattcataattgtgagcggataacaatttcacacaggaaacaaaatccat
FT                   \ ggccatgattact
FT                   \    ...attact
FT                   EcoRI = G^AATT C"
FT   -               550..2781
FT                   /note="pUC18 455..2686 2232bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2781 BP; 704 A; 692 C; 697 G; 688 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg
     actctagagg atccccgggt accgagctcg aattacttga caattagtta actatttgtt
     ataatgaatt cataattgtg agcggataac aatttcacac aggaaacaaa atccatggcc
     atgattactc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa
     ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga
     gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt
     gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct
     cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
     cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
     acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
     ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
     ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
     gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
     gcgtggcgct ttctcaaagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
     ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
     actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
     gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
     ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta
     ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
     gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
     tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
     tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta
     aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg
     aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg
     tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc
     gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg
     agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
     aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag
     gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat
     caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc
     cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc
     ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
     ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac
     gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt
     cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc
     gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa
     caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
     tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat
     acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa
     aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc
     gtatcacgag gccctttcgt c
//