back Return to this vector's summary.
ID   PET2A      preliminary; circular DNA; SYN; 4642 BP.
XX
AC   IG9870;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pET-2a - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pET-2a)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(T7)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ ctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata, Tphi term
FT                   -> pAR939 4483bp
FT                   1. pAR939 BamHI 4483bp, T7 3' gene 10
FT                   EcoRV linker 6bp gatatc
FT                   -> pAR1032 4489bp
FT                   1. pAR1032 NdeI 4489bp 2297..2297
FT                   Klenow
FT                   -> pAR2067 4491bp [unique NdeI at gene 10 init]
FT                   1. T7 TaqI-RsaI 118bp 22880..22998, -23 to +96 phi10
FT                   \ cgaaattaatacgactcactatagggagaccacaacggtt
FT                   \ tccctctagaaataattttgtttaactttaagaaggagatatacatatgg
FT                   \ ctagcatgactggtggac
FT                   BamHI linker 10bp cgggatcccg:BamHI linker 12bp
FT                   \ cgcggatccgcg
FT                   2. pAR2067 BamHI 4491bp 376..376, tet
FT                   -> pAR2084 4619bp
FT                   1. pAR2084 BamHI 4619bp
FT                   Klenow
FT                   BglII linker 8bp gagatctc
FT                   -> pET-2a 4631bp"
FT   -               1..379
FT                   /note="pBR322 1..379 379bp
FT                   BamHI = G^GATC C
FT                   \              gatatcgatc"
FT   -               380..389
FT                   /note="gatatcgatc 10bp
FT                   \   gatatcgatc
FT                   BamHI = G^GATC C
FT                   HhaI =       G CG^C
FT                   \              cgctg..."
FT   -               390..513
FT                   /note="T7 24104..24227 124bp
FT                   \ cgctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata
FT                   \ ...ctata
FT                   HhaI = GCG^C
FT                   BamHI =  G^GATCC
FT                   \          gatcgagatctcgatcccg"
FT   -               514..532
FT                   /note="gatcgagatctcgatcccg 19bp
FT                   \ gatcgagatctcgatcccg
FT                   \                    tcgaaat..."
FT   -               533..650
FT                   /note="T7 22880..22997 118bp
FT                   \ tcgaaattaatacgactcactatagggagaccacaacggtttccctctaga
FT                   \ aataattttgtttaactttaagaaggagatatacatatggctagcatgac
FT                   \ tggtggacagcaaatgg
FT                   \ ...aaatgg
FT                   \          cgcg"
FT   -               651..654
FT                   /note="cgcg 4bp
FT                   \     cgcg
FT                   BamHI =  G^GATCC"
FT   -               655..2577
FT                   /note="pBR322 376..2298 1923bp
FT                   NdeI = CA^TA TG
FT                   NdeI =    CA^TATG"
FT   -               2578..4642
FT                   /note="pBR322 2297..4361 2065bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4642 BP; 1066 A; 1270 C; 1204 G; 1102 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcg atatcgatcc gctgctaaca aagcccgaaa ggaagctgag
     ttggctgctg ccaccgctga gcaataacta gcataacccc ttggggcctc taaacgggtc
     ttgaggggtt ttttgctgaa aggaggaact atagatcgag atctcgatcc cgtcgaaatt
     aatacgactc actataggga gaccacaacg gtttccctct agaaataatt ttgtttaact
     ttaagaagga gatatacata tggctagcat gactggtgga cagcaaatgg cgcggatcct
     ctacgccgga cgcatcgtgg ccggcatcac cggcgccaca ggtgcggttg ctggcgccta
     tatcgccgac atcaccgatg gggaagatcg ggctcgccac ttcgggctca tgagcgcttg
     tttcggcgtg ggtatggtgg caggccccgt ggccggggga ctgttgggcg ccatctcctt
     gcatgcacca ttccttgcgg cggcggtgct caacggcctc aacctactac tgggctgctt
     cctaatgcag gagtcgcata agggagagcg tcgaccgatg cccttgagag ccttcaaccc
     agtcagctcc ttccggtggg cgcggggcat gactatcgtc gccgcactta tgactgtctt
     ctttatcatg caactcgtag gacaggtgcc ggcagcgctc tgggtcattt tcggcgagga
     ccgctttcgc tggagcgcga cgatgatcgg cctgtcgctt gcggtattcg gaatcttgca
     cgccctcgct caagccttcg tcactggtcc cgccaccaaa cgtttcggcg agaagcaggc
     cattatcgcc ggcatggcgg ccgacgcgct gggctacgtc ttgctggcgt tcgcgacgcg
     aggctggatg gccttcccca ttatgattct tctcgcttcc ggcggcatcg ggatgcccgc
     gttgcaggcc atgctgtcca ggcaggtaga tgacgaccat cagggacagc ttcaaggatc
     gctcgcggct cttaccagcc taacttcgat cactggaccg ctgatcgtca cggcgattta
     tgccgcctcg gcgagcacat ggaacgggtt ggcatggatt gtaggcgccg ccctatacct
     tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga cctgaatgga
     agccggcggc acctcgctaa cggattcacc actccaagaa ttggagccaa tcaattcttg
     cggagaactg tgaatgcgca aaccaaccct tggcagaaca tatccatcgc gtccgccatc
     tccagcagcc gcacgcggcg catctcgggc agcgttgggt cctggccacg ggtgcgcatg
     atcgtgctcc tgtcgttgag gacccggcta ggctggcggg gttgccttac tggttagcag
     aatgaatcac cgatacgcga gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc
     tgagcaacaa catgaatggt cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag
     tcagcgccct gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt
     ggaacaccta catctgtatt aacgaagcgc tggcattgac cctgagtgat ttttctctgg
     tcccgccgca tccataccgc cagttgttta ccctcacaac gttccagtaa ccgggcatgt
     tcatcatcag taacccgtat cgtgagcatc ctctctcgtt tcatcggtat cattaccccc
     atgaacagaa atccccctta cacggaggca tcagtgacca aacaggaaaa aaccgccctt
     aacatggccc gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg
     gacgcggatg aacaggcaga catctgtgaa tcgcttcacg accacgctga tgagctttac
     cgcagctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg
     gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg
     tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga
     gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat
     gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc
     ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
     ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
     agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
     taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
     cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
     tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
     gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
     gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
     tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
     gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
     cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
     aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
     tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
     ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
     attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
     ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt
     ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa
     taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt
     tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac
     gaggcccttt cgtcttcaag aa
//