back Return to this vector's summary.
ID   PEV41A     preliminary; circular DNA; SYN; 2812 BP.
XX
AC   L11614;
XX
DT   26-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pEV41a - complete.
XX
KW   cloning vector; beta-lactamase; carrier protein.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-2812
RC   pEV40a, pEV40b, pEV40c from pEV39a & oligo
RC   pEV41a, pEV41b, pEV41c from pEV40a
RA   Pohlner J., Kraemer J., Meyer T.F.;
RT   "A plasmid system for high-level expression and in vitro processing
RT   of recombinant proteins";
RL   Gene 130:121-126(1993).
XX
CC   NCBI gi: 208987
CC   NM (pEV41a)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pEV40a NcoI
FT                   Klenow
FT                   2. oligo NcoI-SmaI-EcoRI-PstI-ClaI-BamHI-HindIII 54bp
FT                   \ acccccgggaattctgcagcatcgatgtcgacggatccaagcttgactga
FT                   \ ctga
FT                   -> pEV41a 2812bp"
FT   misc_feature    1..42
FT                   /note="from pBR322, 417..376"
FT   promoter        43..285
FT                   /note="PRO bacteriophage lambda promoter PL;
FT                   major leftward"
FT   misc_feature    43..285
FT                   /note="from bacteriophage lambda, 35711..35468"
FT   misc_feature    289..453
FT                   /note="from bacteriophage MS2, 1629..1790"
FT   misc_feature    454..631
FT                   /note="synthetic region"
FT   misc_feature    508..548
FT                   /note="MCS"
FT   terminator      565..615
FT                   /note="TER bacteriophage fd terminator"
FT   misc_feature    632..2509
FT                   /note="from pBR322, 2299..4177"
FT   rep_origin      869..869
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_feature    2510..2812
FT                   /note="from pMK20, 2494..2796"
FT   CDS             421..558
FT                   /note="GEN E. coli carrier protein;
FT                   contains 6xHis tag and Igase cleavage site;
FT                   NCBI gi: 208988"
FT   CDS             complement(1627..2487)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp);
FT                   NCBI gi: 208989"
XX
SQ   Sequence 2812 BP; 743 A; 720 C; 663 G; 686 T; 0 other;
     gcgccggtga tgccggccac gatgcgtccg gcgtagagga tctctcacct accaaacaat
     gcccccctgc aaaaaataaa ttcatataaa aaacatacag ataaccatct gcggtgataa
     attatctctg gcggtgttga cataaatacc actggcggtg atactgagca catcagcagg
     acgcactgac caccatgaag gtgacgctct taaaattaag ccctgaagaa gggcagcatt
     caaagcagaa ggctttgggg tgtgtgatac gaaacgaagc attggaataa ttccgactgc
     gagcttattg ttaaggcaat gcaaggtctc ctaaaagatg gaaacccgat tccctcagca
     atcgcagcaa actccggcat ctactaatag acgccggcca ttcaaacatg aggattaccc
     atgtcgaaga caacaaagaa gttcaactct ttacaccacc atcaccacca tggccagcag
     cagcagccgg ctccgcgtcc gccgaccccc gggaattctg cagcatcgat gtcgacggat
     ccaagcttga ctgactgagt cgagatacaa ttaaaggctc cttttggagc cttttttttt
     ggagattttc aacgtggatc actcgagctt gatgcggtgt gaaataccgc acagatgcgt
     aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc
     ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac
     agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa
     ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
     caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
     gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
     cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta
     tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
     gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
     cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
     tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
     tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
     caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
     aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
     cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
     ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc
     tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc
     atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc
     tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc
     aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
     catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt
     gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc
     ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa
     aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt
     atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg
     cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc
     gagttgctct tgcccggcgt caacacggga taataccgcg ccacatagca gaactttaaa
     agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt
     gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt
     caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag
     ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatg taagcagaca
     gttttattgt tcatgatgat atatttttat cttgtgcaat gtaacatcag agattttgag
     acacaacgtg gctttgttga ataaatcgaa cttttgctga gttgaaggat cagatcacgc
     atcttcccga caacgcagac cgttccgtgg caaagcaaaa gttcaaaatc accaactggt
     ccacctacaa caaagctctc atcaaccgtg gctccctcac tttctggctg gatgatgggg
     cgattcaggc ctggtatgag tcagcaacac cttcttcacg aggcagacct ca
//