back Return to this vector's summary.
ID   PEX11      preliminary; circular DNA; SYN; 5813 BP.
AC   X03174; ATCC37708;
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli plasmid vector pEX11 - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   pEX11 from pEX1 & oligo
RC   pEX12 from pEX2 & oligo
RC   pEX13 from pEX3 & oligo
RA   Kusters J.G., Jager E.J., Van Der Zeijst B.A.;
RT   "Improvement of the cloning linker of the bacterial expression
RT   vector pEX";
RL   Nucleic Acids Res. 17:8007-8007(1989).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   This strain is resistant to 100 ug/ml ampicillin. (personal
CC   communication)
CC   This was constructed from pEX1 by the ligating a synthetic
CC   oligonucleotide into pEX1 cut with XmaI and BamHI.  The
CC   oligonucleotide added several unique restriction sites. [1]
CC   This is one of three bacterial expression vectors (pEX11, ATCC 37708;
CC   pEX12, ATCC 37709; and pEX13, ATCC 37710) which differ by
CC   translational reading frames and which express cro-lacZ fusion
CC   proteins regulated by the PR promoter of bacteriophage lambda. [2]
CC   The recombinant fusion protein generated using this vector is not
CC   solubilized in Triton X-100 lysis procedures and is thus easily
CC   purified, resistant to proteolysis, and easily detected by direct
CC   immunoscreening. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--5.8; BamHI--5.8; PstI--5.8; EcoRI/EcoRV--4.3, 1.9; SalI--5.8.
CC   (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pEX11)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Biores)(ATCC)
CC   HO (E.coli POP2136 [ATCC 47049])(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pEX1)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pEX1 remove SmaI/XmaI-BamHI 3bp 3204..3207,
FT                   \ MCS 5784bp
FT                   2. oligo XmaI-BamHI 29bp ccggggtacccaattcactagtgcatgcg
FT                   -> pEX11 5813bp"
FT   -               1..3203
FT                   /note="pEX1 1..3203 3203bp
FT                   SmaI = XmaI = CCC^GGG"
FT   -               3204..3232
FT                   /note="ccggggtacccaattcactagtgcatgcg 29bp
FT                   BamHI = G^GATCC"
FT   -               3233..5813
FT                   /note="pEX1 3207..5787 2581bp"
FT   misc_binding    0..0
FT                   /note="MCS SmaI-XmaI-KpnI-EcoRI-SpeI-SphI-BamHI-
FT                   SalI-PstI"
FT   misc_binding    0..0
FT                   /note="SIT unique SmaI-XmaI-KpnI-EcoRI-SpeI-SphI-
FT                   BamHI-SalI-PstI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO bacteriophage lambda pR"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
SQ   Sequence 5813 BP; 1388 A; 1520 C; 1546 G; 1359 T; 0 other;
     cgcaagggat aaatatctaa caccgtgcgt gttgactatt ttacctctgg cggtgataat
     ggttgcatgt actaaggagg ttgtatggaa caacgcataa ccctgaaaga agcttgggat
     cgatccggag cttggctgtt gcccgtctca ctggtgaaaa gaaaaaccac cctggcgccc
     aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag
     gtttcccgac ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa
     gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atggcgcttt
     gcctggtttc cggcaccaga agcggtgccg gaaagctggc tggagtgcga tcttcctgag
     gccgatactg tcgtcgtccc ctcaaactgg cagatgcacg gttacgatgc gcccatctac
     accaacgtaa cctatcccat tacggtcaat ccgccgtttg ttcccacgga gaatccgacg
     ggttgttact cgctcacatt taatgttgat gaaagctggc tacaggaagg ccagacgcga
     attatttttg atggcgttaa ctcggcgttt catctgtggt gcaacgggcg ctgggtcggt
     tacggccagg acagtcgttt gccgtctgaa tttgacctga gcgcattttt acgcgccgga
     gaaaaccgcc tcgcggtgat ggtgctgcgt tggagtgacg gcagttatct ggaagatcag
     gatatgtggc ggatgagcgg cattttccgt gacgtctcgt tgctgcataa accgactaca
     caaatcagcg atttccatgt tgccactcgc tttaatgatg atttcagccg cgctgtactg
     gaggctgaag ttcagatgtg cggcgagttg cgtgactacc tacgggtaac agtttcttta
     tggcagggtg aaacgcaggt cgccagcggc accgcgcctt tcggcggtga aattatcgat
     gagcgtggtg gttatgccga tcgcgtcaca ctacgtctga acgtcgaaaa cccgaaactg
     tggagcgccg aaatcccgaa tctctatcgt gcggtggttg aactgcacac cgccgacggc
     acgctgattg aagcagaagc ctgcgatgtc ggtttccgcg aggtgcggat tgaaaatggt
     ctgctgctgc tgaacggcaa gccgttgctg attcgaggcg ttaaccgtca cgagcatcat
     cctctgcatg gtcaggtcat ggatgagcag acgatggtgc aggatatcct gctgatgaag
     cagaacaact ttaacgccgt gcgctgttcg cattatccga accatccgct gtggtacacg
     ctgtgcgacc gctacggcct gtatgtggtg gatgaagcca atattgaaac ccacggcatg
     gtgccaatga atcgtctgac cgatgatccg cgctggctac cggcgatgag cgaacgcgta
     acgcgaatgg tgcagcgcga tcgtaatcac ccgagtgtga tcatctggtc gctggggaat
     gaatcaggcc acggcgctaa tcacgacgcg ctgtatcgct ggatcaaatc tgtcgatcct
     tcccgcccgg tgcagtatga aggcggcgga gccgacacca cggccaccga tattatttgc
     ccgatgtacg cgcgcgtgga tgaagaccag cccttcccgg ctgtgccgaa atggtccatc
     aaaaaatggc tttcgctacc tggagagacg cgcccgctga tcctttgcga atacgcccac
     gcgatgggta acagtcttgg cggtttcgct aaatactggc aggcgtttcg tcagtatccc
     cgtttacagg gcggcttcgt ctgggactgg gtggatcagt cgctgattaa atatgatgaa
     aacggcaacc cgtggtcggc ttacggcggt gattttggcg atacgccgaa cgatcgccag
     ttctgtatga acggtctggt ctttgccgac cgcacgccgc atccagcgct gacggaagca
     aaacaccagc agcagttttt ccagttccgt ttatccgggc aaaccatcga agtgaccagc
     gaatacctgt tccgtcatag cgataacgag ctcctgcact ggatggtggc gctggatggt
     aagccgctgg caagcggtga agtgcctctg gatgtcgctc cacaaggtaa acagttgatt
     gaactgcctg aactaccgca gccggagagc gccgggcaac tctggctcac agtacgcgta
     gtgcaaccga acgcgaccgc atggtcagaa gccgggcaca tcagcgcctg gcagcagtgg
     cgtctggcgg aaaacctcag tgtgacgctc cccgccgcgt cccacgccat cccgcatctg
     accaccagcg aaatggattt ttgcatcgag ctgggtaata agcgttggca atttaaccgc
     cagtcaggct ttctttcaca gatgtggatt ggcgataaaa aacaactgct gacgccgctg
     cgcgatcagt tcacccgtgc accgctggat aacgacattg gcgtaagtga agcgacccgc
     attgacccta acgcctgggt cgaacgctgg aaggcggcgg gccattacca ggccgaagca
     gcgttgttgc agtgcacggc agatacactt gctgatgcgg tgctgattac gaccgctcac
     gcgtggcagc atcaggggaa aaccttattt atcagccgga aaacctaccg gattgatggt
     agtggtcaaa tggcgattac cgttgatgtt gaagtggcga gcgatacacc gcatccggcg
     cggattggcc tgaactgcca gctggcgcag gtagcagagc gggtaaactg gctcggatta
     gggccgcaag aaaactatcc cgaccgcctt actgccgcct gttttgaccg ctgggatctg
     ccattgtcag acatgtatac cccgtacgtc ttcccgagcg aaaacggtct gcgctgcggg
     acgcgcgaat tgaattatgg cccacaccag tggcgcggcg acttccagtt caacatcagc
     cgctacagtc aacagcaact gatggaaacc agccatcgcc atctgctgca cgcggaagaa
     ggcacatggc tgaatatcga cggtttccat atggggattg gtggcgacga ctcctggagc
     ccgtcagtat cggcggaatt cccccggggt acccaattca ctagtgcatg cggatccgtc
     gacctgcagc caagcttgct gattgattga ccggatcgat ccggctctag aattaattca
     cctcgaaagc aagctgataa accgatacaa ttaaaggctc cttttggagc cttttttttt
     ggagattttc aacgtgaaaa aattattatt cgcaattcaa gctaattcac ctagaaagca
     agctgataaa ccgatacaat taaaggctcc ttttggagcc tttttttttg gagattttca
     acgtgaaaaa attattattc gcaattcaag ctctgcctcg cgcgtttcgg tgatgacggt
     gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc
     gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc
     atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc
     agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa
     aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc
     ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag
     gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa
     aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc
     gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc
     ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg
     cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt
     cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc
     gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc
     cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag
     agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg
     ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa
     ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag
     gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact
     cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa
     attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt
     accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag
     ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca
     gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc
     agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt
     ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg
     ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca
     gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg
     ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca
     tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg
     tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct
     cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca
     tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca
     gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg
     tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac
     ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt
     attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc
     cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat
     taacctataa aaataggcgt atcacgaggc cctttcgtct tcaagaatta att