back Return to this vector's summary.
ID   PEX12      preliminary; circular DNA; SYN; 5808 BP.
XX
AC   X03174; ATCC37709;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pEX12 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pEX11 from pEX1 & oligo
RC   pEX12 from pEX2 & oligo
RC   pEX13 from pEX3 & oligo
RA   Kusters J.G., Jager E.J., Van Der Zeijst B.A.;
RT   "Improvement of the cloning linker of the bacterial expression
RT   vector pEX";
RL   Nucleic Acids Res. 17:8007-8007(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   This strain is resistant to 100 ug/ml ampicillin. (personal
CC   communication)
CC   This is one of three bacterial expression vectors (pEX11, ATCC 37708;
CC   pEX12, ATCC 37709; and pEX13, ATCC 37710) which differ by
CC   translational reading frames and which express cro-lacZ fusion
CC   proteins regulated by the PR promoter of bacteriophage lambda. [2]
CC   This was constructed from pEX2 by ligating a synthetic oligonucleotide
CC   into pEX2 cut with EcoRI and BamHI.  The oligonucleotide added several
CC   unique restriction sites. [1]
CC   The recombinant fusion protein generated using this vector is not
CC   solubilized in Triton X-100 lysis procedures and is thus easily
CC   purified, resistant to proteolysis, and easily detected by direct
CC   immunoscreening. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--5.8; BamHI--5.8; PstI--5.8. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pEX12)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Biores)(ATCC)
CC   HO (E.coli POP2136 [ATCC 47049])(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pEX2)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pEX2 remove EcoRI-BamHI 10bp 3197..3207,
FT                   \ MCS 5777bp
FT                   2. oligo EcoRI-BamHI 31bp
FT                   \ aatttttcccggggtaccgaattcgcatgcg
FT                   -> pEX12 5808bp [no SpeI]"
FT   -               1..3196
FT                   /note="pEX2 1..3196 3196bp
FT                   EcoRI = G^AATTC"
FT   -               3197..3227
FT                   /note="aatttttcccggggtaccgaattcgcatgcg 31bp
FT                   BamHI = G^GATCC"
FT   -               3228..5808
FT                   /note="pEX2 3207..5787 2581bp"
FT   misc_binding    0..0
FT                   /note="MCS SmaI-XmaI-KpnI-EcoRI-SphI-BamHI-SalI-PstI"
FT   misc_binding    0..0
FT                   /note="SIT unique SmaI-XmaI-KpnI-EcoRI-SphI-BamHI-
FT                   SalI-PstI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO bacteriophage lambda PR"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 5808 BP; 1386 A; 1516 C; 1546 G; 1360 T; 0 other;
     cgcaagggat aaatatctaa caccgtgcgt gttgactatt ttacctctgg cggtgataat
     ggttgcatgt actaaggagg ttgtatggaa caacgcataa ccctgaaaga agcttgggat
     cgatccggag cttggctgtt gcccgtctca ctggtgaaaa gaaaaaccac cctggcgccc
     aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag
     gtttcccgac ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa
     gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atggcgcttt
     gcctggtttc cggcaccaga agcggtgccg gaaagctggc tggagtgcga tcttcctgag
     gccgatactg tcgtcgtccc ctcaaactgg cagatgcacg gttacgatgc gcccatctac
     accaacgtaa cctatcccat tacggtcaat ccgccgtttg ttcccacgga gaatccgacg
     ggttgttact cgctcacatt taatgttgat gaaagctggc tacaggaagg ccagacgcga
     attatttttg atggcgttaa ctcggcgttt catctgtggt gcaacgggcg ctgggtcggt
     tacggccagg acagtcgttt gccgtctgaa tttgacctga gcgcattttt acgcgccgga
     gaaaaccgcc tcgcggtgat ggtgctgcgt tggagtgacg gcagttatct ggaagatcag
     gatatgtggc ggatgagcgg cattttccgt gacgtctcgt tgctgcataa accgactaca
     caaatcagcg atttccatgt tgccactcgc tttaatgatg atttcagccg cgctgtactg
     gaggctgaag ttcagatgtg cggcgagttg cgtgactacc tacgggtaac agtttcttta
     tggcagggtg aaacgcaggt cgccagcggc accgcgcctt tcggcggtga aattatcgat
     gagcgtggtg gttatgccga tcgcgtcaca ctacgtctga acgtcgaaaa cccgaaactg
     tggagcgccg aaatcccgaa tctctatcgt gcggtggttg aactgcacac cgccgacggc
     acgctgattg aagcagaagc ctgcgatgtc ggtttccgcg aggtgcggat tgaaaatggt
     ctgctgctgc tgaacggcaa gccgttgctg attcgaggcg ttaaccgtca cgagcatcat
     cctctgcatg gtcaggtcat ggatgagcag acgatggtgc aggatatcct gctgatgaag
     cagaacaact ttaacgccgt gcgctgttcg cattatccga accatccgct gtggtacacg
     ctgtgcgacc gctacggcct gtatgtggtg gatgaagcca atattgaaac ccacggcatg
     gtgccaatga atcgtctgac cgatgatccg cgctggctac cggcgatgag cgaacgcgta
     acgcgaatgg tgcagcgcga tcgtaatcac ccgagtgtga tcatctggtc gctggggaat
     gaatcaggcc acggcgctaa tcacgacgcg ctgtatcgct ggatcaaatc tgtcgatcct
     tcccgcccgg tgcagtatga aggcggcgga gccgacacca cggccaccga tattatttgc
     ccgatgtacg cgcgcgtgga tgaagaccag cccttcccgg ctgtgccgaa atggtccatc
     aaaaaatggc tttcgctacc tggagagacg cgcccgctga tcctttgcga atacgcccac
     gcgatgggta acagtcttgg cggtttcgct aaatactggc aggcgtttcg tcagtatccc
     cgtttacagg gcggcttcgt ctgggactgg gtggatcagt cgctgattaa atatgatgaa
     aacggcaacc cgtggtcggc ttacggcggt gattttggcg atacgccgaa cgatcgccag
     ttctgtatga acggtctggt ctttgccgac cgcacgccgc atccagcgct gacggaagca
     aaacaccagc agcagttttt ccagttccgt ttatccgggc aaaccatcga agtgaccagc
     gaatacctgt tccgtcatag cgataacgag ctcctgcact ggatggtggc gctggatggt
     aagccgctgg caagcggtga agtgcctctg gatgtcgctc cacaaggtaa acagttgatt
     gaactgcctg aactaccgca gccggagagc gccgggcaac tctggctcac agtacgcgta
     gtgcaaccga acgcgaccgc atggtcagaa gccgggcaca tcagcgcctg gcagcagtgg
     cgtctggcgg aaaacctcag tgtgacgctc cccgccgcgt cccacgccat cccgcatctg
     accaccagcg aaatggattt ttgcatcgag ctgggtaata agcgttggca atttaaccgc
     cagtcaggct ttctttcaca gatgtggatt ggcgataaaa aacaactgct gacgccgctg
     cgcgatcagt tcacccgtgc accgctggat aacgacattg gcgtaagtga agcgacccgc
     attgacccta acgcctgggt cgaacgctgg aaggcggcgg gccattacca ggccgaagca
     gcgttgttgc agtgcacggc agatacactt gctgatgcgg tgctgattac gaccgctcac
     gcgtggcagc atcaggggaa aaccttattt atcagccgga aaacctaccg gattgatggt
     agtggtcaaa tggcgattac cgttgatgtt gaagtggcga gcgatacacc gcatccggcg
     cggattggcc tgaactgcca gctggcgcag gtagcagagc gggtaaactg gctcggatta
     gggccgcaag aaaactatcc cgaccgcctt actgccgcct gttttgaccg ctgggatctg
     ccattgtcag acatgtatac cccgtacgtc ttcccgagcg aaaacggtct gcgctgcggg
     acgcgcgaat tgaattatgg cccacaccag tggcgcggcg acttccagtt caacatcagc
     cgctacagtc aacagcaact gatggaaacc agccatcgcc atctgctgca cgcggaagaa
     ggcacatggc tgaatatcga cggtttccat atggggattg gtggcgacga ctcctggagc
     ccgtcagtat cggcggaatt tttcccgggg taccgaattc gcatgcggat ccgtcgacct
     gcagccaagc ttgctgattg attgaccgga tcgatccggc tctagaatta attcacctcg
     aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt tttttggaga
     ttttcaacgt gaaaaaatta ttattcgcaa ttcaagctaa ttcacctaga aagcaagctg
     ataaaccgat acaattaaag gctccttttg gagccttttt ttttggagat tttcaacgtg
     aaaaaattat tattcgcaat tcaagctctg cctcgcgcgt ttcggtgatg acggtgaaaa
     cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg atgccgggag
     cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg cagccatgac
     ccagtcacgt agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt
     gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac
     cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg
     cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat
     aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc
     gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc
     tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga
     agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt
     ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct cagttcggtg
     taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc
     gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg
     gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc
     ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg
     ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc
     gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct
     caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt
     taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa
     aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa
     tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc
     tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct
     gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca
     gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt
     aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt
     gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc
     ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc
     tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt
     atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact
     ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc
     ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt
     ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg
     atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct
     gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa
     tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt
     ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc
     acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat gacattaacc
     tataaaaata ggcgtatcac gaggcccttt cgtcttcaag aattaatt
//