back Return to this vector's summary.
ID   PFD51      preliminary; circular DNA; SYN; 3716 BP.
XX
AC   IG9917;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pFD51 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pFD51 from pKO-1 & piVX
RC   pFD39, pFD40 from pFD1 & lambda & pKO-1
RC   pFD40 from pFD39
RC   pFD41 from pFD39 & pFD51
RC   [pCB8 from pCB series]
RC   pFD21 from pHL128 & pCB8
RC   pFD22, pFD23 from pFD21
RC   pFD24 from pEX110 & pFD51
RC   pFD53 from pFD1 & pFD51
RA   Rak B., Von Reutern M.;
RT   "Insertion element IS5 contains a third gene";
RL   EMBO J. 3:807-811(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pFD51)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pKO-1)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pKO-1 remove EcoRI-HindIII 295bp
FT                   \ 3979..3980..294, 3685bp [297bp]
FT                   2. piVX EcoRI-HindIII 78bp, MCS
FT                   -> pFD51 3763bp"
FT   -               1..3685
FT                   /note="pKO-1 294..3978 3685bp
FT                   EcoRI = G^AATTC
FT                   \         aattct..."
FT   -               3686..3716
FT                   /note="aattctcatgtttgacagcttatcatcgata 31bp
FT                   \ ...tcgata
FT                   HindIII = A^AGCTT"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3716 BP; 931 A; 959 C; 946 G; 880 T; 0 other;
     agcttactcc ccatccccgg gcaataaggg ctgcacgcgc acttttatcc gcctctgctg
     cgctccgcca ccgtacgtaa atttatggtt ggttatgaaa tgctggcaga gacccagcga
     gacctgaccg cagaacaggc agcagagcgt ttgcgcgcag tcagcgatat ccattttcgc
     gaatccggag tgtaagaaat gagtctgaaa gaaaaaacac aatctctgtt tgccaacgca
     tttggctacc ctgccactca caccattcag gcgcctggcc gcgtgaattt gattggtgaa
     cacaccgact acaacgacgg tttcgttctg ccctgcgcga ttgattatca aaccgtgatc
     agttgtgcac cacgcgatga ccgtaaagtt cgcgtgatgg cagccgatta tgaaaatcag
     ctcgacgagt tttccctcga tgcgcccatt gtcgcacatg aaaactatca atgggctaac
     tacgttcgtg gcgtggtgaa acatctgcaa ctgcgtaaca acagcttcgg cggcgtggac
     atggtgatca gcggcaatgt gccgacgggt gccgggttaa gttcttccgc ttcactggaa
     gtcgcggtcg gaaccgtatt gcagcagctt tatcatctgc cgctggacgg cgcacaaatc
     gcgcttaacg gtcaggaagc agaaaaccag tttgtaggct gtaactgcgg gatcatggat
     cagctaattt ccgcgctcgg caagaaagat catgccttgc tgatcgattg ccgctcactg
     gggaccaaag cagtttccat gcccaaaggt gtggctgtcg tcatcatcaa cagtaacttc
     aaacgtaccc tggttggcag cgaatacaac acccgtcgtg aacagtgcga aaccggtgcg
     cgtttcttcc agcagccagc cctgcgtgat gtcaccattg aagagttcaa cgctgttgcg
     catgaactgg acccgatcgt ggcaaaacgc gtgcgtcata tactgactga aaacgcccgc
     accgttgaag ctgccagcgc gctggagcaa ggcgacctga aacgtatggg cgagttgatg
     gcggagtctc atgcctctat gcgcgatgat ttcgaaatca ccgtgccgca aattgacact
     ctggtagaaa tcgtcaaagc tgtgattggc gacaaaggtg gcgtacgcat gaccggcggc
     ggatttggcg gctgtatcgt cgcgctgatc ccggaagagc tggtgcctgc cgcacagcaa
     gctgtcgctg aacaatatga agcaaaaaca ggtattaaag agacttttta cgtttgtaaa
     ccatcacaag gagcaggaca gtgctgaacg aaactcccgc actggcaccc gatggcagcc
     gtaccgactg ttctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca
     gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca
     gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga
     tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac
     catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct
     tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca
     gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac
     atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt
     ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg
     cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc
     tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
     gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc
     aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac
     tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt
     aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct
     aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc
     ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt
     ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg
     atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc
     atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa
     tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag
     gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg
     tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga
     gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag
     cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa
     gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc
     atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca
     aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg
     atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat
     aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc
     aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaacacgg
     gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg
     gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt
     gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca
     ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata
     ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac
     atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa
     gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt
     atcacgaggc cctttcgtct tcaagaattc tcatgtttga cagcttatca tcgata
//