back Return to this vector's summary.
ID   PFH807     preliminary; circular DNA; SYN; 3973 BP.
XX
AC   K00453;
XX
DT   15-FEB-1984 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pFH807 - complete, pACYC177 amp/phix174 ori.
XX
KW   cloning vector; ampicillin resistance; drug resistance gene;
KW   origin of replication; plasmid.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-50
RC   pFH614, pFH704, pFH807, pFH812, pFH903 from pACYC177 & oligo, phiX174
RA   Heidekamp F., Baas P.D., Van Boom J.H., Veeneman G.H.,
RA   Zipursky S.L., Jansz H.S.;
RT   "Construction and characterization of recombinant plasmid DNAs
RT   containing sequences of the origin of bacteriophage Phi-X174 DNA
RT   replication";
RL   Nucleic Acids Res. 9:3335-3354(1981).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 208935
CC   NM (pFH807)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pACYC177)(phi-x174 am3)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pACYC177 HincII 3941bp 4..4
FT                   2. oligo 32bp caacttgatattaatacaacttgatattaata,
FT                   \ phiX174 4299..4314
FT                   -> pFH807 3973bp"
FT   -               1..3
FT                   /note="pACYC177 1..3 3bp
FT                   HindII = HincII = GTY^RAC
FT                   \                     caact..."
FT   -               4..35
FT                   /note="caacttgatattaatacaacttgatattaata 32bp
FT                   \            ...taata
FT                   HindII = HincII = GTY^RAC"
FT   -               36..3973
FT                   /note="pACYC177 4..3941 3938bp"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    11..11
FT                   /note="SIT HincII"
FT   rep_origin      11..26
FT                   /note="ORI phi-x174"
XX
SQ   Sequence 3973 BP; 1040 A; 897 C; 995 G; 1041 T; 0 other;
     gttcaacttg atattaatac aacttgatat taatagacgc cgggcaagag caactcggtc
     gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca gaaaagcatc
     ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg agtgataaca
     ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc gcttttttgc
     acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca
     taccaaacga cgagcgtgac accacgatgc ctgcagcaat ggcaacaacg ttgcgcaaac
     tattaactgg cgaactactt actctagctt cccggcaaca attaatagac tggatggagg
     cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg tttattgctg
     ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg gggccagatg
     gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac
     gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa ctgtcagacc
     aagtttactc atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct
     aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc
     actgagcgtc agacccctta ataagatgat cttcttgaga tcgttttggt ctgcgcgtaa
     tctcttgctc tgaaaacgaa aaaaccgcct tgcagggcgg tttttcgaag gttctctgag
     ctaccaactc tttgaaccga ggtaactggc ttggaggagc gcagtcacca aaacttgtcc
     tttcagttta gccttaaccg gcgcatgact tcaagactaa ctcctctaaa tcaattacca
     gtggctgctg ccagtggtgc ttttgcatgt ctttccgggt tggactcaag acgatagtta
     ccggataagg cgcagcggtc ggactgaacg gggggttcgt gcatacagtc cagcttggag
     cgaactgcct acccggaact gagtgtcagg cgtggaatga gacaaacgcg gccataacag
     cggaatgaca ccggtaaacc gaaaggcagg aacaggagag cgcacgaggg agccgccagg
     gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc caccactgat ttgagcgtca
     gatttcgtga tgcttgtcag gggggcggag cctatggaaa aacggctttg ccgcggccct
     ctcacttccc tgttaagtat cttcctggca tcttccagga aatctccgcc ccgttcgtaa
     gccatttccg ctcgccgcag tcgaacgacc gagcgtagcg agtcagtgag cgaggaagcg
     gaatatatcc tgtatcacat attctgctga cgcaccggtg cagccttttt tctcctgcca
     catgaagcac ttcactgaca ccctcatcag tgccaacata gtaagccagt atacactccg
     ctagcgctga ggtctgcctc gtgaagaagg tgttgctgac tcataccagg cctgaatcgc
     cccatcatcc agccagaaag tgagggagcc acggttgatg agagctttgt tgtaggtgga
     ccagttggtg attttgaact tttgctttgc cacggaacgg tctgcgttgt cgggaagatg
     cgtgatctga tccttcaact cagcaaaagt tcgatttatt caacaaagcc acgttgtgtc
     tcaaaatctc tgatgttaca ttgcacaaga taaaaatata tcatcatgaa caataaaact
     gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc
     ttgctcgagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc
     tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc
     gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat
     ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg
     tactcctgat gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt
     attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg
     ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct
     cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga
     gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataagcttt tgccattctc
     accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg
     gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct
     tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca
     aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga
     gtttttctaa tcagaattgg ttaattggtt gtaacactgg cagagcatta cgctgacttg
     acgggacggc ggctttgttg aataaatcga acttttgctg agttgaagga tcagatcacg
     catcttcccg acaacgcaga ccgttccgtg gcaaagcaaa agttcaaaat caccaactgg
     tccacctaca acaaagctct catcaaccgt ggctccctca ctttctggct ggatgatggg
     gcgattcagg cctggtatga gtcagcaaca ccttcttcac gaggcagacc tcagcgctca
     aagatgcagg ggtaaaagct aaccgcatct ttaccgacaa ggcatccggc agttcaacag
     atcgggaagg gctggatttg ctgaggatga aggtggagga aggtgatgtc attctggtga
     agaagctcga ccgtcttggc cgcgacaccg ccgacatgat ccaactgata aaagagtttg
     atgctcaggg tgtagcggtt cggtttattg acgacgggat cagtaccgac ggtgatatgg
     ggcaaatggt ggtcaccatc ctgtcggctg tggcacaggc tgaacgccgg aggatcctag
     agcgcacgaa tgagggccga caggaagcaa agctgaaagg aatcaaattt ggccgcaggc
     gtaccgtgga caggaacgtc gtgctgacgc ttcatcagaa gggcactggt gcaacggaaa
     ttgctcatca gctcagtatt gcccgctcca cggtttataa aattcttgaa gacgaaaggg
     cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc
     aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca
     ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa
     aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
     ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
     gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag
     ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc
     ggtattatcc cgt
//