back Return to this vector's summary.
ID   PFH903     preliminary; circular DNA; SYN; 3973 BP.
XX
AC   K00451;
XX
DT   15-FEB-1984 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pFH903 - complete, pACYC177 kmr/phi-x174 ori.
XX
KW   cloning vector; drug resistance gene; kanamycin resistance;
KW   origin of replication; plasmid.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-50
RC   pFH614, pFH704, pFH807, pFH812, pFH903 from pACYC177 & oligo, phiX174
RA   Heidekamp F., Baas P.D., Van Boom J.H., Veeneman G.H.,
RA   Zipursky S.L., Jansz H.S.;
RT   "Construction and characterization of recombinant plasmid DNAs
RT   containing sequences of the origin of bacteriophage Phi-X174 DNA
RT   replication";
RL   Nucleic Acids Res. 9:3335-3354(1981).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NCBI gi: 208933
CC   NM (pFH903)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pACYC177)(phi-x174 am3)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pACYC177 SmaI 3941bp 2229..2229
FT                   2. oligo 32bp caacttgatattaatacaacttgatattaata,
FT                   \ phiX174 4299..4314
FT                   -> pFH903 3973bp"
FT   -               1..2228
FT                   /note="pACYC177 1..2228 2228bp
FT                   SmaI = CCC^GGG
FT                   \          caact..."
FT   -               2229..2260
FT                   /note="caacttgatattaatacaacttgatattaata 32bp
FT                   \ ...taata
FT                   SmaI = CCC^GGG"
FT   -               2261..3973
FT                   /note="pACYC177 2229..3941 1713bp"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   misc_binding    11..11
FT                   /note="SIT SmaI"
FT   rep_origin      11..26
FT                   /note="ORI phiX174"
XX
SQ   Sequence 3973 BP; 1040 A; 897 C; 995 G; 1041 T; 0 other;
     gttgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt
     gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc
     agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga
     ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat
     cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct
     gcagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc
     cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg
     gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc
     ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg
     acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca
     ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta
     aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc
     aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccttaat aagatgatct
     tcttgagatc gttttggtct gcgcgtaatc tcttgctctg aaaacgaaaa aaccgccttg
     cagggcggtt tttcgaaggt tctctgagct accaactctt tgaaccgagg taactggctt
     ggaggagcgc agtcaccaaa acttgtcctt tcagtttagc cttaaccggc gcatgacttc
     aagactaact cctctaaatc aattaccagt ggctgctgcc agtggtgctt ttgcatgtct
     ttccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg actgaacggg
     gggttcgtgc atacagtcca gcttggagcg aactgcctac ccggaactga gtgtcaggcg
     tggaatgaga caaacgcggc cataacagcg gaatgacacc ggtaaaccga aaggcaggaa
     caggagagcg cacgagggag ccgccagggg gaaacgcctg gtatctttat agtcctgtcg
     ggtttcgcca ccactgattt gagcgtcaga tttcgtgatg cttgtcaggg gggcggagcc
     tatggaaaaa cggctttgcc gcggccctct cacttccctg ttaagtatct tcctggcatc
     ttccaggaaa tctccgcccc gttcgtaagc catttccgct cgccgcagtc gaacgaccga
     gcgtagcgag tcagtgagcg aggaagcgga atatatcctg tatcacatat tctgctgacg
     caccggtgca gccttttttc tcctgccaca tgaagcactt cactgacacc ctcatcagtg
     ccaacatagt aagccagtat acactccgct agcgctgagg tctgcctcgt gaagaaggtg
     ttgctgactc ataccaggcc tgaatcgccc catcatccag ccagaaagtg agggagccac
     ggttgatgag agctttgttg taggtggacc agttggtgat tttgaacttt tgctttgcca
     cggaacggtc tgcgttgtcg ggaagatgcg tgatctgatc cttcaactca gcaaaagttc
     gatttattca acaaagccac gttgtgtctc aaaatctctg atgttacatt gcacaagata
     aaaatatatc atcatgaaca ataaaactgt ctgcttacat aaacagtaat acaaggggtg
     ttatgagcca tattcaacgg gaaacgtctt gctcgaggcc gcgattaaat tccaacatgg
     atgctgattt atatgggtat aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa
     tctatcgatt gtatgggaag cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta
     gcgttgccaa tgatgttaca gatgagatgg tcagactaaa ctggctgacg gaatttatgc
     ctcttccgac catcaagcat tttatccgta ctcctgatga tgcatggtta ctcaccactg
     cgatccccca acttgatatt aatacaactt gatattaata gggaaaacag cattccaggt
     attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg
     ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct
     cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga
     gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataagcttt tgccattctc
     accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg
     gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct
     tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca
     aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga
     gtttttctaa tcagaattgg ttaattggtt gtaacactgg cagagcatta cgctgacttg
     acgggacggc ggctttgttg aataaatcga acttttgctg agttgaagga tcagatcacg
     catcttcccg acaacgcaga ccgttccgtg gcaaagcaaa agttcaaaat caccaactgg
     tccacctaca acaaagctct catcaaccgt ggctccctca ctttctggct ggatgatggg
     gcgattcagg cctggtatga gtcagcaaca ccttcttcac gaggcagacc tcagcgctca
     aagatgcagg ggtaaaagct aaccgcatct ttaccgacaa ggcatccggc agttcaacag
     atcgggaagg gctggatttg ctgaggatga aggtggagga aggtgatgtc attctggtga
     agaagctcga ccgtcttggc cgcgacaccg ccgacatgat ccaactgata aaagagtttg
     atgctcaggg tgtagcggtt cggtttattg acgacgggat cagtaccgac ggtgatatgg
     ggcaaatggt ggtcaccatc ctgtcggctg tggcacaggc tgaacgccgg aggatcctag
     agcgcacgaa tgagggccga caggaagcaa agctgaaagg aatcaaattt ggccgcaggc
     gtaccgtgga caggaacgtc gtgctgacgc ttcatcagaa gggcactggt gcaacggaaa
     ttgctcatca gctcagtatt gcccgctcca cggtttataa aattcttgaa gacgaaaggg
     cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc
     aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca
     ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa
     aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
     ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
     gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag
     ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc
     ggtattatcc cgt
//