back Return to this vector's summary.
ID   PFR10      preliminary; circular DNA; SYN; 2397 BP.
XX
AC   K01449;
XX
DT   07-NOV-1984 (Rel. 1, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pFR10 - complete, lacZ fragment.
XX
KW   cloning vector; beta-galactosidase; galactosidase; lac operon;
KW   lacZ gene; promoter region.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-71
RC   pCV1 from pBR322 & linker
RC   pSKS101 from pUC7 & Tn5
RC   pSKS114 from pUC7 & Tn9
RC   pMC1827, pMC1828 from pMC1403 & pSKS101
RC   pMC1843 from pMC1827
RC   pMLB1034 from pMC1403
RC   pMC1844 from pMLB1034 & pUC7
RC   pSKS104 from pMC1403 & pUC7
RC   pSKS105 from pMC1403 & pUC8
RC   pSKS106 from pMC1403 & pUC9
RC   pSKS107 from pSKS105
RC   pFR10 from pSKS106 & pCV1
RC   pFR97 from pSKS104 & pFR10
RC   pFR98 from pSKS105 & pFR10
RC   pFR109 from pSKS106 & pFR10
RC   plasmid from pMC279 & pMC1403
RC   plasmid2 from plasmid & pSKS101
RC   pMC1871 from plasmid2 & pMC1843
RA   Shapira S.K., Chou J., Richaud F.V., Casadaban M.J.;
RT   "New versatile plasmid vectors for expression of hybrid proteins
RT   coded by a cloned gene fused to lacZ gene sequences encoding an
RT   enzymatically active carboxy-terminal portion of beta-galactosidase";
RL   Gene 25:71-82(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   A synthetic Sac1-Xho1-Xba1-Cla1 sequence from pCV1 plasmid
CC   (inserted into Cla1 site in TcR promoter region of pBR322,
CC   resulting in a TcR, ApR phenotype), and a linker sequence from
CC   pSKS106 plasmid (lac fusion vector) were joined to form pFR10.
CC   NCBI gi: 209000
CC   NM (pFR10)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(pSKS106)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 ClaI 4361bp 25..25, tet gene
FT                   2. SacI-XhoI-XbaI-ClaI-HindIII linker 31bp
FT                   \ atcggagctcgagtctagaatcgataagctt
FT                   -> pCV1 4392bp
FT                   1. pSKS106 HindIII-HaeIII 40bp 234..274, MCS
FT                   \ pUC9 HindIII 234
FT                   \ pUC9 HaeIII =  38 274 376 674 1261 1528 1608 2066
FT                   \  2500 2518 2529
FT                   \ pMC1403 HaeIII = 110 199 220 271 328 541 725 1229
FT                   \ 1769 1780 1798 2232 2690 2770 3037 3624
FT                   \ 3756 3873 4042 4117 4849 5020 5115 6073 6084 6280
FT                   \ 6335 6472 6719 7043 7960 7966 8308 8720 9779
FT                   2. pCV1 remove HindIII-PvuII 2037bp 61..2098,
FT                   \ tet gene/pBR322 30..2067/2324bp
FT                   -> pFR10 2400bp"
FT   -               1..26
FT                   /note="pBR322 1..26 26bp
FT                   ClaI = AT^CG AT
FT                   \            atcggag..."
FT   -               27..57
FT                   /note="atcggagctcgagtctagaatcgataagctt 31bp
FT                   \ ...aagctt
FT                   ClaI =   AT^CGAT"
FT   -               58..62
FT                   /note="pBR322 25..29 5bp
FT                   HindIII = A^AGCTT"
FT   -               63..102
FT                   /note="pUC9 234..273 40bp
FT                   HaeIII = GG^CC
FT                   PvuII = CAG^CTG"
FT   -               103..2397
FT                   /note="pBR322 2067..4361 2295bp"
FT   misc_recomb     28..29
FT                   /note="plasmid pCV1/plasmid pSKS106 (HindIII)"
FT   misc_binding    0..0
FT                   /note="MCS SacI-XhoI-XbaI-ClaI-HindIII-PstI-SalI-
FT                   BamHI-SmaI/XmaI-EcoRI-HaeIII/PvuII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 2397 BP; 605 A; 604 C; 595 G; 593 T; 0 other;
     ttctcatgtt tgacagctta tcatcgatcg gagctcgagt ctagaatcga taagcttcga
     taagcttggc tgcaggtcga cggatccccg ggaattcact ggctgcctcg cgcgtttcgg
     tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta
     agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg
     gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg
     gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc
     gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc
     tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc
     acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg
     aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat
     cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag
     gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga
     tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg
     tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt
     cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac
     gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc
     ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt
     ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc
     ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc
     agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg
     aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag
     atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg
     tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt
     tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca
     tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca
     gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc
     tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt
     ttgcgcaacg ttgttgccat tgctgcaggc atcgtggtgt cacgctcgtc gtttggtatg
     gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc
     aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg
     ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga
     tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga
     ccgagttgct cttgcccggc gtcaacacgg gataataccg cgccacatag cagaacttta
     aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg
     ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact
     ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata
     agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt
     tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa
     ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt
     atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct tcaagaa
//