back Return to this vector's summary.
ID   PGENE8459  preliminary; circular DNA; SYN; 3255 BP.
XX
AC   IG5170;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGENE8459 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGENE8459v3 from pGENE8459 & oligo
RA   Taira K., Nakagawa K., Nishikawa S., Furukawa K.;
RT   "Construction of a novel RNA-transcript-trimming plasmid which can be
RT   used both in vitro in place of run-off and (G)-free transcriptions
RT   and in vivo as multi-sequences transcription";
RL   Nucleic Acids Res. 19:5125-5130(1991).
XX
RN   [2]
RC   from HIV-1
RA   Rossi J.J., Cantin E.M., Zaia J.A., Ladne P.A., Chen J.,
RA   Stephens D.A., Sarver N., Chang P.S.;
RT   "Ribozymes as therapies for AIDS";
RL   Ann. N.Y. Acad. Sci. 616:184-200(1990).
XX
RN   [3]
RC   pGENE8459 from pUC119 & synthetic 5'/3' ribozymes
RA   Taira K., Oda M., Shinshi H., Maeda H., Furukawa K.;
RT   "Construction of a novel artificial-ribozyme-releasing plasmid";
RL   Protein Engineering 3:733-737(1990).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pGENE8459)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC119)(pAM19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC119 remove EcoRI-PstI 43bp 873..916,
FT                   \ 3119bp
FT                   2. oligo EcoRI-PstI 136bp
FT                   \ aattcgcgtgtaatacgactcactatagggagctcaactggtgctgatg
FT                   \ agtccgtgaggacgaaacgggtctgacggatccgtcgacggatctagat
FT                   \ ccgtcctgatgagtccgtgaggacgaaacggatctgca
FT                   -> pGENE8459 3255bp"
FT   -               1..872
FT                   /note="pUC119 1..872 872bp
FT                   EcoRI = G^AATTC"
FT   -               873..1008
FT                   /note="136bp
FT                   \ aattcgcgtgtaatacgactcactatagggagctcaactggtgctgatg
FT                   \ agtccgtgaggacgaaacgggtctgacggatccgtcgacggatctagat
FT                   \ ccgtcctgatgagtccgtgaggacgaaacggatctgca
FT                   PstI = CTGCA^G"
FT   -               1009..3255
FT                   /note="pUC119 916..3162 2247bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3255 BP; 784 A; 838 C; 812 G; 821 T; 0 other;
     agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagcttg
     catgcctgca ggtcgactct agaggatccc cgggtaccga gctcgaattc actggccgtc
     gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca
     catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa
     cagttgcgca gcctgaatgg cgaatggcgc ctgatgcggt attttctcct tacgcatctg
     tgcggtattt cacaccgcat acgtcaaagc aaccatagta cgcgccctgt agcggcgcat
     taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag
     cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc
     aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc
     ccaaaaaact tgatttgggt gatggttcac gtagtgggcc atcgccctga tagacggttt
     ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa
     caacactcaa ccctatctcg ggctattctt ttaattcgcg tgtaatacga ctcactatag
     ggagctcaac tggtgctgat gagtccgtga ggacgaaacg ggtctgacgg atccgtcgac
     ggatctagat ccgtcctgat gagtccgtga ggacgaaacg gatctgcaat gagctgattt
     aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttta tggtgcactc
     tcagtacaat ctgctctgat gccgcatagt taagccagcc ccgacacccg ccaacacccg
     ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg
     tctccgggag ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgagacgaa
     agggcctcgt gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga
     cgtcaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa
     tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt
     gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg
     cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag
     atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg
     agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg
     gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc atacactatt
     ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga
     cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac
     ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc
     atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc
     gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac
     tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag
     gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg
     gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta
     tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg
     ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata
     tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt
     ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc
     ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct
     tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa
     ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag
     tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc
     tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg
     actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca
     cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat
     gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg
     tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc
     ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc
     ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc
     cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg
     cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga
     gcgaggaagc ggaag
//