back Return to this vector's summary.
ID   PGEX3T     preliminary; circular DNA; SYN; 4979 BP.
XX
AC   IG5017;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGEX-3T - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGEX-3T from pGEX-2T
RC   pRIL6.96 from pRIL6.94 & pGEX-3T
RA   Frorath B., Abney C.C., Berthold H., Scanarini M., Northemann W.;
RT   "Production of recombinant rat interleukin-6 in Escherichia coli
RT   using a novel highly efficient expression vector pGEX-3T";
RL   Biotechniques 12:558-563(1992).
XX
RN   [2]
RC   pRIL6C.91 from pGEXII & rat IL-6 gene
RC   lambda RIL5G.3, lambda RIL5G.5 from lambda ZAP II & rat IL-6 gene
RC   lambda RIL5G.9 from lambda ZAP II & rat IL-6 gene
RC   pRIL6C.92 from pcDL-SR296 & pRIL6C.91
RC   [pRIL6.94 from rat IL-6 gene]
RA   Northemann W., Braciak T.A., Hattori M., Lee F., Fey G.H.;
RT   "Structure of the rat interleukin-6 gene and its regulation in
RT   macrophage-derived cells";
RL   J. Biol. Chem. 264:16072-16082(1989).
XX
RN   [3]
RC   pcDL-SR296 from pcDV1
RA   Takebe Y., Seiki M., Fujisawa J.I., Hoy P., Yokota K., Arai K.I.,
RA   Yoshida M., Arai N.;
RT   "SR alpha promoter: an efficient and versatile mammalian cDNA
RT   expression system composed of the simian virus 40 early promoter
RT   and the R-U5 segment of human T-cell leukemia virus type 1 long
RT   terminal repeat";
RL   Mol. Cell. Biol. 8:466-472(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS, oligonucleotide linker.
CC   NM (pGEX-3T)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pGEX-2T)
CC   BR ()
CC   OF (pRIL6.96 also from pRIL6.94)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEX-2T remove BamHI-EcoRI 10bp 931..941,
FT                   \ MCS/4938bp
FT                   blunt end:blunt end
FT                   2. oligo BamHI-HindIII-EcoRI-SmaI/XmaI-SalI-XhoI-KpnI
FT                   \ 40bp atccgaagcttcgaattccccgggtcgactcgaggtacca, MCS
FT                   -> pGEX-3T 4978bp [mutated EcoRI site]"
FT   -               1..930
FT                   /note="pGEX-2T 1..930 930bp
FT                   BamHI = G^GATCC"
FT   -               931..971
FT                   /note="gatccgaagcttcgaattccccgggtcgactcgaggtacca 41bp
FT                   \ ...ggtacca
FT                   EcoRI =    G^AATTC"
FT   -               972..4979
FT                   /note="pGEX-2T 941..4948 4008bp"
FT   promoter        181..257
FT                   /note="PRO E. coli tac"
FT   CDS             258..917
FT                   /note="GEN Schistosoma japonicum glutathione
FT                   S-transferase gene (GST)"
FT   misc_binding    918..935
FT                   /note="SIT thrombin cleavage site"
FT   misc_binding    918..971
FT                   /note="MCS BamHI-HindIII-EcoRI-SmaI/XmaI-SalI-
FT                   XhoI-KpnI, 40bp linker inserted into pGEX-2T
FT                   BamHI-EcoRI"
FT   misc_binding    930..935
FT                   /note="SIT BamHI"
FT   misc_binding    937..942
FT                   /note="SIT HindIII"
FT   misc_binding    944..949
FT                   /note="SIT EcoRI"
FT   misc_binding    950..955
FT                   /note="SIT SmaI or XmaI"
FT   misc_binding    955..960
FT                   /note="SIT SalI"
FT   misc_binding    960..965
FT                   /note="SIT XhoI"
FT   misc_binding    965..970
FT                   /note="SIT KpnI"
FT   misc_feature    0..0
FT                   /note="TER stop codons in all 3 frames"
FT   CDS             1386..2245
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             3327..4406
FT                   /note="REP E. coli lacIq repressor gene"
FT   misc_binding    0..0
FT                   /note="SIT destroyed EcoRI"
XX
SQ   Sequence 4979 BP; 1231 A; 1202 C; 1291 G; 1255 T; 0 other;
     acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
     gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
     tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
     tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
     cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
     aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
     gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
     ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
     tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
     ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
     ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
     atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
     tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
     aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
     ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
     atcctccaaa atcggatctg gttccgcgtg gatccgaagc ttcgaattcc ccgggtcgac
     tcgaggtacc aaattcatcg tgactgactg acgatctgcc tcgcgcgttt cggtgatgac
     ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat
     gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca
     gccatgaccc agtcacgtag cgatagcgga gtgtataatt cttgaagacg aaagggcctc
     gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt
     ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca
     aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg
     aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc
     cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg
     ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt
     cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta
     ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat
     gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga
     gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca
     acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact
     cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc
     acgatgcctg cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact
     ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt
     ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt
     gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt
     atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata
     ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag
     attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat
     ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa
     aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca
     aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt
     ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg
     tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc
     ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga
     cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc
     agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc
     gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca
     ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg
     tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta
     tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct
     cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag
     tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa
     gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc
     ataaattccg acaccatcga atggtgcaaa acctttcgcg gtatggcatg atagcgcccg
     gaagagagtc aattcagggt ggtgaatgtg aaaccagtaa cgttatacga tgtcgcagag
     tatgccggtg tctcttatca gaccgtttcc cgcgtggtga accaggccag ccacgtttct
     gcgaaaacgc gggaaaaagt ggaagcggcg atggcggagc tgaattacat tcccaaccgc
     gtggcacaac aactggcggg caaacagtcg ttgctgattg gcgttgccac ctccagtctg
     gccctgcacg cgccgtcgca aattgtcgcg gcgattaaat ctcgcgccga tcaactgggt
     gccagcgtgg tggtgtcgat ggtagaacga agcggcgtcg aagcctgtaa agcggcggtg
     cacaatcttc tcgcgcaacg cgtcagtggg ctgatcatta actatccgct ggatgaccag
     gatgccattg ctgtggaagc tgcctgcact aatgttccgg cgttatttct tgatgtctct
     gaccagacac ccatcaacag tattattttc tcccatgaag acggtacgcg actgggcgtg
     gagcatctgg tcgcattggg tcaccagcaa atcgcgctgt tagcgggccc attaagttct
     gtctcggcgc gtctgcgtct ggctggctgg cataaatatc tcactcgcaa tcaaattcag
     ccgatagcgg aacgggaagg cgactggagt gccatgtccg gttttcaaca aaccatgcaa
     atgctgaatg agggcatcgt tcccactgcg atgctggttg ccaacgatca gatggcgctg
     ggcgcaatgc gcgccattac cgagtccggg ctgcgcgttg gtgcggatat ctcggtagtg
     ggatacgacg ataccgaaga cagctcatgt tatatcccgc cgttaaccac catcaaacag
     gattttcgcc tgctggggca aaccagcgtg gaccgcttgc tgcaactctc tcagggccag
     gcggtgaagg gcaatcagct gttgcccgtc tcactggtga aaagaaaaac caccctggcg
     cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga
     caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac
     tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt
     gagcggataa caatttcaca caggaaacag ctatgaccat gattacggat tcactggccg
     tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag
     cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc
     aacagttgcg cagcctgaat ggcgaatggc gctttgcctg gtttccggca ccagaagcgg
     tgccggaaag ctggctggag tgcgatcttc ctgaggccga tactgtcgtc gtcccctcaa
     actggcagat gcacggttac gatgcgccca tctacaccaa cgtaacctat cccattacgg
     tcaatccgcc gtttgttccc acggagaatc cgacgggttg ttactcgctc acatttaatg
     ttgatgaaag ctggctacag gaaggccaga cgcgaattat ttttgatggc gttggaatt
//