back Return to this vector's summary.
ID   PGEX3X     preliminary; circular DNA; SYN; 4952 BP.
XX
AC   A01439; A01580; IG1073; M21676; M97937;
XX
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGEX-3X - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from pSj1 & pIC19H
RC   pSj10 from plasmid & ptac or ptac12deltaEco
RC   p4.5 from pSj5 & pMC9
RC   pSj10Bam7Stop7 from pSj10
RC   pGEX-1 from pBR322 & pSj10Bam7Stop7 & p4.5 & oligo
RC   pGEX-2T from pGEX-1 & oligo, thrombin protease site
RC   pGEX-3X from pGEX-1 & oligo, factor Xa site
RA   Smith D.B., Johnson K.S.;
RT   "Single-step purification of polypeptides expressed in Escherichia
RT   coli as fusions with glutathione S-transferase";
RL   Gene 67:31-40(1988).
XX
CC   thrombin or factor Xa protease sites to cleave protein from fusion.
CC   pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs.
CC   NM (pGEX-3X)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Pharmacia)(ATCC)
CC   HO (E.coli)
CC   CP ()
CC   FN (expression)(cloning directional)
CC   SE (affinity)(color yellow)
CC   PA (p4.5)(pS)(pGEX-1)
CC   BR (pGEX-2T)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEX-1 BamHI 4941bp
FT                   2. oligo BamHI-BamHI 20bp ggatctgatcgaaggtcgtg,
FT                   \ factor Xa
FT                   -> pGEX-3X 4952bp"
FT   misc_binding    0..0
FT                   /note="MCS unique BamHI-SmaI-EcoRI"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    0..0
FT                   /note="SIT unique PstI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="REP E. coli lacI repressor gene"
FT   misc_binding    0..0
FT                   /note="SIT unique MluI"
FT   misc_binding    0..0
FT                   /note="SIT unique BstEII"
FT   misc_binding    0..0
FT                   /note="SIT unique ApaI"
FT   misc_binding    0..0
FT                   /note="SIT unique BssHII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRV"
FT   misc_binding    0..0
FT                   /note="SIT unique NarI"
FT   promoter        0..0
FT                   /note="PRO E. coli tac (trp and lac)"
FT   CDS             0..0
FT                   /note="GEN Schistosoma japonicum
FT                   glutathione S-transferase (GST)"
XX
SQ   Sequence 4952 BP; 1226 A; 1192 C; 1286 G; 1248 T; 0 other;
     agcttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
     gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
     tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
     tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
     cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
     aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
     gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
     ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
     tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
     ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
     ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
     atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
     tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
     aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
     ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
     atcctccaaa atcggatctg atcgaaggtc gtgggatccc cgggaattca tcgtgactga
     ctgacgatct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc
     ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc
     gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc
     ggagtgtata attcttgaag acgaaagggc ctcgtgatac gcctattttt ataggttaat
     gtcatgataa taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga
     acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa
     ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt
     gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg
     ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg
     gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg
     agcactttta aagttctgct atgtggcgcg gtattatccc gtgttgacgc cgggcaagag
     caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca
     gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg
     agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc
     gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg
     aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgcagcaat ggcaacaacg
     ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac
     tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg
     tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg
     gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact
     atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa
     ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt
     aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag
     ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct
     ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt
     tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg
     cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct
     gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc
     gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg
     tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa
     ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg
     gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg
     ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga
     tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt
     ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct
     gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga
     acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcctgat gcggtatttt
     ctccttacgc atctgtgcgg tatttcacac cgcataaatt ccgacaccat cgaatggtgc
     aaaacctttc gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat
     gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt
     tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg
     gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc gggcaaacag
     tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc gcaaattgtc
     gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa
     cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt
     gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga agctgcctgc
     actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa cagtattatt
     ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt gggtcaccag
     caaatcgcgc tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg tctggctggc
     tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga aggcgactgg
     agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat cgttcccact
     gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc
     gggctgcgcg ttggtgcgga tatctcggta gtgggatacg acgataccga agacagctca
     tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg gcaaaccagc
     gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca gctgttgccc
     gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc
     gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag
     tgagcgcaac gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt
     tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa
     cagctatgac catgattacg gattcactgg ccgtcgtttt acaacgtcgt gactgggaaa
     accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta
     atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat
     ggcgctttgc ctggtttccg gcaccagaag cggtgccgga aagctggctg gagtgcgatc
     ttcctgaggc cgatactgtc gtcgtcccct caaactggca gatgcacggt tacgatgcgc
     ccatctacac caacgtaacc tatcccatta cggtcaatcc gccgtttgtt cccacggaga
     atccgacggg ttgttactcg ctcacattta atgttgatga aagctggcta caggaaggcc
     agacgcgaat tatttttgat ggcgttggaa tt
//