back Return to this vector's summary.
ID   PGEX5      preliminary; circular DNA; SYN; 4968 BP.
XX
AC   IG2002; M97937;
XX
DT   10-AUG-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGEX-5 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-4968
RC   pGEX-2T/Sal from pGEX-2T
RC   pGEX-5G/LIC from pGEX-2T/Sal
RA   Haun R.S., Moss J.;
RT   "Ligation-independent cloning of glutathione S-transferase fusion
RT   genes for expression in Escherichia coli";
RL   Gene 112:37-43(1992).
XX
CC   NM (pGEX-5)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(expression)
CC   SE ()
CC   PA (S.japonicum)(E.coli)(pGEX-1)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEX-2T 4948bp, C terminus of GST gene
FT                   mutagenesis, to make SalI at C terminus of GST gene
FT                   -> pGEX-2T/Sal 4948bp
FT                   1. pGEX-2T/Sal remove SalI-BamHI 36bp 931..?,
FT                   \ GST C end 4912bp
FT                   2. oligo SalI-BamHI 56bp
FT                   \ tcgaccatcctccaggaggaggaggaggcctggttcggcggagcgaggcg
FT                   \ cagttg
FT                   -> pGEX-5 4968bp"
FT   CDS             258..935
FT                   /note="GEN Schistosoma japonicum
FT                   glutathione-S-transferase gene [1,2], partial"
FT   misc_feature    894..899
FT                   /note="SIT SalI [2]"
FT   mutation        895..895
FT                   /note="g in wildtype [1,2]"
FT   repeat_region   909..923
FT                   /note="glycine rich coding region;
FT                   rpt_unit=909..911 [2]"
FT   misc_feature    921..935
FT                   /note="forward ligation-independent
FT                   cloning sequence [2]"
FT   misc_feature    930..935
FT                   /note="SIT SacII [2]"
FT   misc_feature    complement(934..947)
FT                   /note="reverse ligation-independent
FT                   cloning sequence [2]"
FT   misc_feature    950..955
FT                   /note="SIT BamHI [2]"
FT   misc_feature    955..960
FT                   /note="SIT SmaI [2]"
FT   misc_feature    960..965
FT                   /note="SIT EcoRI [2]"
FT   misc_feature    0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4968 BP; 1226 A; 1197 C; 1298 G; 1247 T; 0 other;
     acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
     gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
     tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
     tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
     cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
     aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
     gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
     ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
     tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
     ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
     ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
     atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
     tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
     aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
     ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtgtcgacc
     atcctccagg aggaggagga ggcctggttc cgcggagcga ggcgcagttg gatccccggg
     aattcatcgt gactgactga cgatctgcct cgcgcgtttc ggtgatgacg gtgaaaacct
     ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag
     acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca
     gtcacgtagc gatagcggag tgtataattc ttgaagacga aagggcctcg tgatacgcct
     atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg
     gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc
     gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag
     tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt
     tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt
     gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga
     acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt
     tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga
     gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag
     tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg
     accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg
     ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgc
     agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg
     gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc
     ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg
     tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac
     ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact
     gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa
     acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa
     aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg
     atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc
     gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac
     tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca
     ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt
     ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc
     ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg
     aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc
     cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
     gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct
     ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
     cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt
     tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac
     cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg
     cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca taaattccga
     caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga tagcgcccgg aagagagtca
     attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt atgccggtgt
     ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg cgaaaacgcg
     ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg tggcacaaca
     actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg ccctgcacgc
     gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg ccagcgtggt
     ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc acaatcttct
     cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg atgccattgc
     tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg accagacacc
     catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg agcatctggt
     cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg tctcggcgcg
     tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc cgatagcgga
     acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa tgctgaatga
     gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg gcgcaatgcg
     cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg gatacgacga
     taccgaagac agctcatgtt atatcccgcc gtcaaccacc atcaaacagg attttcgcct
     gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg cggtgaaggg
     caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc ccaatacgca
     aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac aggtttcccg
     actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact cattaggcac
     cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg agcggataac
     aatttcacac aggaaacagc tatgaccatg attacggatt cactggccgt cgttttacaa
     cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct
     ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc
     agcctgaatg gcgaatggcg ctttgcctgg tttccggcac cagaagcggt gccggaaagc
     tggctggagt gcgatcttcc tgaggccgat actgtcgtcg tcccctcaaa ctggcagatg
     cacggttacg atgcgcccat ctacaccaac gtaacctatc ccattacggt caatccgccg
     tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc
     tggctacagg aaggccagac gcgaattatt tttgatggcg ttggaatt
//